Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22884
Trapped Gene
5033413D22Rik (ENSMUSG00000075225)
Vector Insertion
Chr 10: 41300964 - 41301198
Public Clones not available
Private Clones OST282117 (lexicon) OST177021 (lexicon) OST99615 (lexicon) OST99564 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098264 (Chr10:41300965..41301197 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCTTGTGGAAGCGTCTG Chr10:41301057..41301076 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098264 (Chr10:41300965..41301197 -)
Downstram Exon
ENSMUSE00000666450 (Chr10:41300965..41301197 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCTTGTGGAAGCGTCTG Chr10:41301057..41301076 59.98 50 CAGACGCTTCCACAAGATGA Chr10:41301035..41301054 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711586 Chr10:41307156..41307247 AGATGGTGGACCATTTCCAG Chr10:41307197..41307216 59.78 50
upstream ENSMUSE00000713451 Chr10:41307156..41307247 AGATGGTGGACCATTTCCAG Chr10:41307197..41307216 59.78 50
upstream ENSMUSE00000297058 Chr10:41306058..41306210 GTGACTGTGACCGCAGAGTG Chr10:41306172..41306191 60.53 60
upstream ENSMUSE00000666459 Chr10:41306058..41306210 GTGACTGTGACCGCAGAGTG Chr10:41306172..41306191 60.53 60
upstream ENSMUSE00000098264 Chr10:41300965..41301197 TCATCTTGTGGAAGCGTCTG Chr10:41301057..41301076 59.98 50
upstream ENSMUSE00000666450 Chr10:41300965..41301197 TCATCTTGTGGAAGCGTCTG Chr10:41301057..41301076 59.98 50

*** Putative Vector Insertion (Chr 10: 41300964 - 41301198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297043 Chr10:41300031..41300169 AGAGCTTTCATGCTGGGGTA Chr10:41300115..41300134 59.84 50
downstream ENSMUSE00000666458 Chr10:41300031..41300169 AGAGCTTTCATGCTGGGGTA Chr10:41300115..41300134 59.84 50
downstream ENSMUSE00000666449 Chr10:41298921..41299041 No primer for this exon
downstream ENSMUSE00000666457 Chr10:41298921..41299041 No primer for this exon
downstream ENSMUSE00000666448 Chr10:41289649..41289758 TGACTTGGTGTTTCCAACGA Chr10:41289716..41289735 60.13 45
downstream ENSMUSE00000666456 Chr10:41289649..41289758 TGACTTGGTGTTTCCAACGA Chr10:41289716..41289735 60.13 45
downstream ENSMUSE00000666447 Chr10:41280917..41281066 AGCTTCTGCCTGGTATGCTG Chr10:41280911..41280930 60.56 55
downstream ENSMUSE00000666455 Chr10:41280917..41281066 AGCTTCTGCCTGGTATGCTG Chr10:41280911..41280930 60.56 55
downstream ENSMUSE00000644001 Chr10:41276571..41276627 GTCCAGCACAGTCTTCAGAGG Chr10:41276551..41276571 60.04 57.14
downstream ENSMUSE00000666446 Chr10:41276571..41276624 GTCCAGCACAGTCTTCAGAGG Chr10:41276551..41276571 60.04 57.14
downstream ENSMUSE00000666454 Chr10:41276571..41276624 GTCCAGCACAGTCTTCAGAGG Chr10:41276551..41276571 60.04 57.14
downstream ENSMUSE00000644000 Chr10:41275779..41275946 CAGAAACAACGCCTGCACTA Chr10:41275775..41275794 60.05 50
downstream ENSMUSE00000666453 Chr10:41275779..41275946 CAGAAACAACGCCTGCACTA Chr10:41275775..41275794 60.05 50
downstream ENSMUSE00000643999 Chr10:41273222..41273374 AGCCCCAGGTTTTCTTTAGC Chr10:41273241..41273260 59.72 50
downstream ENSMUSE00000666452 Chr10:41272879..41273013 CGCTTTGCACAGTAGAGCAG Chr10:41272929..41272948 59.95 55
downstream ENSMUSE00000643997 Chr10:41272124..41272276 TGGAGTAAAGCCGCTTCTTG Chr10:41272184..41272203 60.51 50
downstream ENSMUSE00000644008 Chr10:41270528..41270737 TGCCGAGTGACAGAGTCTTG Chr10:41270660..41270679 60.18 55
downstream ENSMUSE00000666445 Chr10:41270414..41270737 CCTCACCTGCTTCAGGTCTC Chr10:41270500..41270519 59.99 60
downstream ENSMUSE00000643996 Chr10:41268734..41270737 CACCTTCTGTGTCGGGTTTT Chr10:41270013..41270032 60.01 50
downstream ENSMUSE00000644007 Chr10:41266689..41266809 GAGGGCCACTGGATGTCATA Chr10:41266690..41266709 60.89 55
downstream ENSMUSE00000644005 Chr10:41261580..41261707 CTTAGGGAGCAGTGGGTCTG Chr10:41261655..41261674 59.86 60
downstream ENSMUSE00000644004 Chr10:41259227..41259348 AGCTGTTTGGGCTTGAAAAG Chr10:41259234..41259253 59.49 45
downstream ENSMUSE00000644003 Chr10:41259039..41259110 TCTCAGACCAACTGCCACAC Chr10:41259055..41259074 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCCAGGACTCTACCCAAA Chr10:41301161..41301181 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCCAGGACTCTACCCAAA Chr10:41301161..41301181 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075225