Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22915
Trapped Gene
Hspa14 (ENSMUSG00000051396)
Vector Insertion
Chr 2: 3428527 - 3429905
Public Clones not available
Private Clones OST281301 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426981 (Chr2:3429906..3430028 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAAGGGTCCTTCGTTGAG Chr2:3429985..3430004 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426981 (Chr2:3429906..3430028 -)
Downstram Exon
ENSMUSE00000570305 (Chr2:3428446..3428526 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAAGGGTCCTTCGTTGAG Chr2:3429985..3430004 59.84 55 CACGTTCCGAGTAAGCAACA Chr2:3428429..3428448 59.9 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426981 Chr2:3429906..3430028 CTGAAGGGTCCTTCGTTGAG Chr2:3429985..3430004 59.84 55

*** Putative Vector Insertion (Chr 2: 3428527 - 3429905) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000570305 Chr2:3428446..3428526 CACGTTCCGAGTAAGCAACA Chr2:3428429..3428448 59.9 50
downstream ENSMUSE00000570304 Chr2:3428287..3428369 CTTTGTTTTGCTGCCAGTCC Chr2:3428322..3428341 60.81 50
downstream ENSMUSE00000161641 Chr2:3420009..3420057 TTCTGAGCTTGTGGATCTGC Chr2:3420012..3420031 59.12 50
downstream ENSMUSE00000161627 Chr2:3419766..3419871 TACCGCAACTTCCCATTTTT Chr2:3419821..3419840 59.45 40
downstream ENSMUSE00000161638 Chr2:3418320..3418410 GTGACAACCACGTCATTTGC Chr2:3418340..3418359 60.02 50
downstream ENSMUSE00000161640 Chr2:3416479..3416583 TCCAATCCCATAAGCAAGGA Chr2:3416480..3416499 60.4 45
downstream ENSMUSE00000161642 Chr2:3415294..3415455 CGATAAGGACGTTCCTCCAA Chr2:3415394..3415413 60.07 50
downstream ENSMUSE00000161637 Chr2:3413836..3413991 ACAAAGCAGTTGGCACTTCC Chr2:3413859..3413878 60.3 50
downstream ENSMUSE00000161625 Chr2:3411770..3411872 AAAAAGCGGAGAACAGAGCA Chr2:3411817..3411836 60.13 45
downstream ENSMUSE00000161634 Chr2:3408793..3409005 GACGTGCTCTCTTTCCCAAC Chr2:3408823..3408842 59.85 55
downstream ENSMUSE00000319365 Chr2:3408209..3408382 GAGTTCAAGGCAAACGGAAG Chr2:3408238..3408257 59.85 50
downstream ENSMUSE00000161629 Chr2:3406970..3407040 No primer for this exon
downstream ENSMUSE00000363565 Chr2:3406126..3406341 TCAGGATGCAACCTCAACAG Chr2:3406241..3406260 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACAAGGTGAGCCTGGGAAG Chr2:3429890..3429910 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACAAGGTGAGCCTGGGAAG Chr2:3429890..3429910 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051396