Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22918
Trapped Gene
Ablim2 (ENSMUSG00000029095)
Vector Insertion
Chr 5: 36100710 - 36141101
Public Clones D124G11 (ggtc) CMHD-GT_437B2-3 (cmhd) (cmhd) CMHD-GT_448B2-3 (cmhd) IST11919F3 (tigm)
IST14633C1 (tigm) IST14575E4 (tigm) IST11974H6 (tigm) IST14575E4 (tigm)
IST11577B6 (tigm) IST14751B7 (tigm) IST14726F7 (tigm) IST14837H3 (tigm)
IST12558E5 (tigm)
Private Clones OST281246 (lexicon) OST136173 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456360 (Chr5:36100580..36100709 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456360 (Chr5:36100580..36100709 +)
Downstram Exon
ENSMUSE00000414129 (Chr5:36141102..36141245 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65 ACACAAAGCACCTGATGTGG Chr5:36141242..36141261 59.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698502 Chr5:36100573..36100709 GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65
upstream ENSMUSE00000456360 Chr5:36100580..36100709 GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65
upstream ENSMUSE00000698500 Chr5:36100615..36100709 GACCACCCTACTGGGAGCTG Chr5:36100672..36100691 62.03 65

*** Putative Vector Insertion (Chr 5: 36100710 - 36141101) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000414129 Chr5:36141102..36141245 ACACAAAGCACCTGATGTGG Chr5:36141242..36141261 59.6 50
downstream ENSMUSE00000185467 Chr5:36145009..36145192 CCATAGAGCCGCTGGTAGTC Chr5:36145096..36145115 59.86 60
downstream ENSMUSE00000185471 Chr5:36149688..36149803 ACTCCTTCCCGTTGAAGGTC Chr5:36149737..36149756 60.49 55
downstream ENSMUSE00000185469 Chr5:36151832..36151958 GCATTGAGGAGTTTCCCACA Chr5:36151946..36151965 61.05 50
downstream ENSMUSE00000185474 Chr5:36154775..36154868 TAATCAGCCTCGCAGTAGGG Chr5:36154807..36154826 60.37 55
downstream ENSMUSE00000698499 Chr5:36157075..36157312 CCCAGCCAGTCTCCATACTC Chr5:36157247..36157266 59.68 60
downstream ENSMUSE00000185475 Chr5:36166674..36166761 GTACATCTCCTCGCCCTCTG Chr5:36166757..36166776 59.83 60
downstream ENSMUSE00000185470 Chr5:36170773..36170831 No primer for this exon
downstream ENSMUSE00000653938 Chr5:36174335..36174391 No primer for this exon
downstream ENSMUSE00000185465 Chr5:36175702..36175779 TGCTCTCCGAAGAAGTCCTG Chr5:36175729..36175748 60.67 55
downstream ENSMUSE00000185463 Chr5:36179597..36179746 GAGCAGCCAAGTCCCTGTAG Chr5:36179645..36179664 60.01 60
downstream ENSMUSE00000698505 Chr5:36182439..36182471 CGTTGGTGAGAGCAACTGAG Chr5:36182465..36182484 59.62 55
downstream ENSMUSE00000185461 Chr5:36183930..36184050 GAGGTTGGGGTGTAGTGTCC Chr5:36184024..36184043 59.28 60
downstream ENSMUSE00000653935 Chr5:36185817..36185915 GAACACGGATGTAGGGCTTG Chr5:36185890..36185909 60.52 55
downstream ENSMUSE00000185476 Chr5:36191453..36191554 TGAGAGACTCGGGGTGCTAC Chr5:36191490..36191509 60.41 60
downstream ENSMUSE00000185462 Chr5:36192165..36192218 No primer for this exon
downstream ENSMUSE00000185464 Chr5:36199777..36199829 TCCTGCTGTCCTGGTCAAAG Chr5:36199830..36199849 61.39 55
downstream ENSMUSE00000185472 Chr5:36200475..36200613 TGGAGAGGTTCCTGGTCAGT Chr5:36200587..36200606 59.68 55
downstream ENSMUSE00000546596 Chr5:36209354..36209415 GGTCCTGGAAGAGTGTCAGG Chr5:36209393..36209412 59.68 60
downstream ENSMUSE00000546592 Chr5:36215819..36215873 No primer for this exon
downstream ENSMUSE00000698511 Chr5:36215819..36215878 No primer for this exon
downstream ENSMUSE00000653933 Chr5:36217282..36217289 No primer for this exon
downstream ENSMUSE00000698507 Chr5:36217480..36217562 CACGAATTCGGTTTGTTACG Chr5:36217527..36217546 59.08 45
downstream ENSMUSE00000358712 Chr5:36217482..36217562 CACGAATTCGGTTTGTTACG Chr5:36217527..36217546 59.08 45
downstream ENSMUSE00000487216 Chr5:36225955..36227619 CACAGTGTCCACCCATTCTG Chr5:36227362..36227381 60 55
downstream ENSMUSE00000653931 Chr5:36225955..36227115 TTACAAACGGCACTGCTGAG Chr5:36227008..36227027 60.05 50
downstream ENSMUSE00000698494 Chr5:36225955..36226068 GGTCAAACTCCTCGATGCTC Chr5:36226018..36226037 59.81 55
downstream ENSMUSE00000698501 Chr5:36225955..36226798 TCTGCCCCTGACAAGTCTTT Chr5:36226482..36226501 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCTCTCTGCTGTGCTCT Chr5:36124674..36124694 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGCTCTCTGCTGTGCTCT Chr5:36124674..36124694 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029095