Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22924
Trapped Gene
Pot1a (ENSMUSG00000029676)
Vector Insertion
Chr 6: 25750511 - 25755874
Public Clones 5SE041F01 (ggtc)
Private Clones OST281128 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702483 (Chr6:25755875..25755941 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTTGTGGAAGTCAAGCAG Chr6:25755899..25755918 58.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702483 (Chr6:25755875..25755941 -)
Downstram Exon
ENSMUSE00000702482 (Chr6:25750284..25750510 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTTGTGGAAGTCAAGCAG Chr6:25755899..25755918 58.65 50 TAGGCTTTCCACAACCGAAG Chr6:25750373..25750392 60.24 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702467 Chr6:25759175..25759195 No primer for this exon
upstream ENSMUSE00000702485 Chr6:25759175..25759226 GCGCCTAGGTCCAGACTTTA Chr6:25759195..25759214 59.48 55
upstream ENSMUSE00000702483 Chr6:25755875..25755941 GCTTTGTGGAAGTCAAGCAG Chr6:25755899..25755918 58.65 50

*** Putative Vector Insertion (Chr 6: 25750511 - 25755874) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702482 Chr6:25750284..25750510 TAGGCTTTCCACAACCGAAG Chr6:25750373..25750392 60.24 50
downstream ENSMUSE00000702481 Chr6:25748009..25748055 No primer for this exon
downstream ENSMUSE00000656206 Chr6:25745082..25745086 No primer for this exon
downstream ENSMUSE00000702473 Chr6:25744908..25744911 No primer for this exon
downstream ENSMUSE00000191394 Chr6:25744560..25744674 TTGGCAATTGTACCTTCCTTG Chr6:25744591..25744611 59.98 42.86
downstream ENSMUSE00000191404 Chr6:25728839..25728969 CTGTGGAAGCGAACAATGTC Chr6:25728824..25728843 59.29 50
downstream ENSMUSE00000191410 Chr6:25725525..25725815 AGTTGAAGACGCCGAGATGT Chr6:25725602..25725621 59.87 50
downstream ENSMUSE00000191395 Chr6:25721519..25721674 ATGGATCTCGCCACTTGAAC Chr6:25721501..25721520 60.08 50
downstream ENSMUSE00000191402 Chr6:25714252..25714424 AAGGGCTTGTATCTGGCAAA Chr6:25714249..25714268 59.71 45
downstream ENSMUSE00000191411 Chr6:25708818..25708903 GAGCTGTCCCCATTTTCTGA Chr6:25708807..25708826 60.19 50
downstream ENSMUSE00000702466 Chr6:25707685..25708903 GAGCTGTCCCCATTTTCTGA Chr6:25708807..25708826 60.19 50
downstream ENSMUSE00000305827 Chr6:25707225..25707287 No primer for this exon
downstream ENSMUSE00000191396 Chr6:25706163..25706319 CCTGGGCAAATAGGATCTCA Chr6:25706188..25706207 60.03 50
downstream ENSMUSE00000191393 Chr6:25703149..25703354 TGTCGCTTTCAGCTTGATGT Chr6:25703248..25703267 59.6 45
downstream ENSMUSE00000191409 Chr6:25702360..25702495 CAGGCATCACACTGTGGAAC Chr6:25702417..25702436 60.16 55
downstream ENSMUSE00000191406 Chr6:25700050..25700138 GAAGGAGTCCACGGTCCTTT Chr6:25700042..25700061 60.49 55
downstream ENSMUSE00000702471 Chr6:25698775..25700138 TCTGGGATTCCGTAATTTGC Chr6:25698789..25698808 59.9 45
downstream ENSMUSE00000191399 Chr6:25698291..25698382 GTCCCGTCATCCAGAGTGAA Chr6:25698300..25698319 61.08 55
downstream ENSMUSE00000191398 Chr6:25695891..25695996 CAGATGCTGGGATCTTGAAAA Chr6:25695947..25695967 60.2 42.86
downstream ENSMUSE00000702476 Chr6:25693737..25694693 AGCAAATTCGTCGCTCTGTT Chr6:25694600..25694619 60.02 45
downstream ENSMUSE00000656204 Chr6:25693735..25694693 AGCAAATTCGTCGCTCTGTT Chr6:25694600..25694619 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTCATTTGTGCTTACCC Chr6:25755837..25755857 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTTCATTTGTGCTTACCC Chr6:25755837..25755857 58.77 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCTTTGTGGAAGTCAAGCA Chr6:25755898..25755918 60.57 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTAACGTGACTGGGAAAACC Chr6:25755875..25755896 58.98 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029676