Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22928
Trapped Gene
Acp2 (ENSMUSG00000002103)
Vector Insertion
Chr 2: 91043854 - 91044396
Public Clones not available
Private Clones OST281012 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000167496 (Chr2:91043758..91043853 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000167496 (Chr2:91043758..91043853 +)
Downstram Exon
ENSMUSE00000167504 (Chr2:91044397..91044483 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687541 Chr2:91043076..91043205 No primer for this exon
upstream ENSMUSE00000167496 Chr2:91043758..91043853 No primer for this exon

*** Putative Vector Insertion (Chr 2: 91043854 - 91044396) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000167504 Chr2:91044397..91044483 No primer for this exon
downstream ENSMUSE00000167495 Chr2:91045913..91046065 No primer for this exon
downstream ENSMUSE00000167498 Chr2:91046167..91046265 No primer for this exon
downstream ENSMUSE00000167497 Chr2:91046345..91046434 No primer for this exon
downstream ENSMUSE00000167505 Chr2:91046874..91047006 No primer for this exon
downstream ENSMUSE00000167500 Chr2:91047974..91048056 No primer for this exon
downstream ENSMUSE00000167501 Chr2:91048197..91048303 No primer for this exon
downstream ENSMUSE00000167499 Chr2:91048418..91048593 No primer for this exon
downstream ENSMUSE00000336658 Chr2:91050764..91053295 No primer for this exon
downstream ENSMUSE00000687536 Chr2:91050764..91050765 No primer for this exon
downstream ENSMUSE00000643354 Chr2:91051144..91051227 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCAAGGTCTCGGGATATG Chr2:91043872..91043892 60.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATCGTGACTGGGAAAACC Chr2:91043901..91043921 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002103