Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22932
Trapped Gene
Xkrx (ENSMUSG00000031258)
Vector Insertion
Chr X: 130692021 - 130696114
Public Clones not available
Private Clones OST280939 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000279206 (ChrX:130696115..130696467 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTAACCCACGCTTTACCT ChrX:130696353..130696372 60.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000279206 (ChrX:130696115..130696467 -)
Downstram Exon
ENSMUSE00000546400 (ChrX:130691752..130692020 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTAACCCACGCTTTACCT ChrX:130696353..130696372 60.5 55 CCTGGCCAGCTATTAGCATC ChrX:130691895..130691914 59.83 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000279206 ChrX:130696115..130696467 GCCTAACCCACGCTTTACCT ChrX:130696353..130696372 60.5 55

*** Putative Vector Insertion (Chr X: 130692021 - 130696114) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000546400 ChrX:130691752..130692020 CCTGGCCAGCTATTAGCATC ChrX:130691895..130691914 59.83 55
downstream ENSMUSE00000546399 ChrX:130683584..130685835 TGTCTGCCAACTTCAACTGC ChrX:130685409..130685428 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCAATCCCCTTCAAACAG ChrX:130696069..130696089 58.88 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTTCTCCTTTTTCATGC ChrX:130696129..130696149 60.33 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031258