Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22944
Trapped Gene
Eif1 (ENSMUSG00000035530)
Vector Insertion
Chr 11: 100182144 - 100182261
Public Clones not available
Private Clones OST280661 (lexicon) OST186481 (lexicon)
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000577257 (Chr11:100181980..100182143 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGATCGCTGATGATTACG Chr11:100182092..100182111 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000577257 (Chr11:100181980..100182143 +)
Downstram Exon
ENSMUSE00000577256 (Chr11:100182262..100182363 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGATCGCTGATGATTACG Chr11:100182092..100182111 60.06 50 CATATGTTCTTGCGCTGGTC Chr11:100182350..100182369 59.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412034 Chr11:100181303..100181474 TCGTATGTCCGCTATCCAGA Chr11:100181440..100181459 59.25 50
upstream ENSMUSE00000577257 Chr11:100181980..100182143 AGGGATCGCTGATGATTACG Chr11:100182092..100182111 60.06 50

*** Putative Vector Insertion (Chr 11: 100182144 - 100182261) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577256 Chr11:100182262..100182363 CATATGTTCTTGCGCTGGTC Chr11:100182350..100182369 59.3 50
downstream ENSMUSE00000249225 Chr11:100182631..100183412 AAGGAGCCTCTGGTCAGACA Chr11:100182996..100183015 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAAGGTGGGTCTGCTGTG Chr11:100182139..100182159 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAAGGTGGGTCTGCTGTG Chr11:100182139..100182159 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035530