Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22962
Trapped Gene
Slc44a2 (ENSMUSG00000057193)
Vector Insertion
Chr 9: 21156996 - 21158125
Public Clones CMHD-GT_473C7-3 (cmhd) CMHD-GT_502H7-3 (cmhd) IST14329C8 (tigm) IST12312E4 (tigm)
IST12049G2 (tigm)
Private Clones OST280146 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638342 (Chr9:21156911..21156995 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACACGCTGTTCCTCTGTT Chr9:21156973..21156992 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638342 (Chr9:21156911..21156995 +)
Downstram Exon
ENSMUSE00000638341 (Chr9:21158126..21159469 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACACGCTGTTCCTCTGTT Chr9:21156973..21156992 60.31 55 ATGCCCCAGTCCTCTAGGTT Chr9:21158390..21158409 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000584922 Chr9:21125265..21125295 GATCGGAAGGACGCAGTCTA Chr9:21125274..21125293 60.36 55
upstream ENSMUSE00000362854 Chr9:21142288..21142406 GGGAAGGATTCGCAGAATTA Chr9:21142373..21142392 59.12 45
upstream ENSMUSE00000638369 Chr9:21142885..21142933 GGACGCCTCAGAAATACGAC Chr9:21142885..21142904 59.7 55
upstream ENSMUSE00000638368 Chr9:21146223..21146296 CTGGCCATCGTAGGCTATGT Chr9:21146260..21146279 60.12 55
upstream ENSMUSE00000638367 Chr9:21146383..21146467 AGACCCTCGGAAGGTGATCT Chr9:21146396..21146415 60.07 55
upstream ENSMUSE00000638366 Chr9:21146627..21146711 ACATCGTGAAGTGTGCCAAC Chr9:21146653..21146672 59.6 50
upstream ENSMUSE00000638365 Chr9:21146839..21146949 AGCAGTGTCCAGACCGCTAT Chr9:21146849..21146868 59.9 55
upstream ENSMUSE00000638364 Chr9:21147042..21147102 TACTCCGAGATGGGGAGTGT Chr9:21147055..21147074 59.53 55
upstream ENSMUSE00000638363 Chr9:21147187..21147310 CGACCTATGAGGACGGACAT Chr9:21147250..21147269 59.95 55
upstream ENSMUSE00000638361 Chr9:21147408..21147491 CAACTCGCCATGCAGATATT Chr9:21147436..21147455 58.75 45
upstream ENSMUSE00000638359 Chr9:21147579..21147691 GGCATTATGGTCTGGGTGAT Chr9:21147640..21147659 59.63 50
upstream ENSMUSE00000638358 Chr9:21149276..21149407 ACTCGAGACTCCGTGGAGAG Chr9:21149300..21149319 59.58 60
upstream ENSMUSE00000638356 Chr9:21149737..21149836 GCGCAAAAGGATATTGATCG Chr9:21149789..21149808 60.56 45
upstream ENSMUSE00000638355 Chr9:21149923..21150015 GCTCTACCCACTGGTGACCT Chr9:21149950..21149969 59.18 60
upstream ENSMUSE00000638354 Chr9:21150353..21150437 TCTGAGGAAAACCTGCAACC Chr9:21150413..21150432 60.23 50
upstream ENSMUSE00000638353 Chr9:21151133..21151395 CTATGCGGAAGCCTGATGAT Chr9:21151332..21151351 60.2 50
upstream ENSMUSE00000638351 Chr9:21151479..21151573 CTTAGCCATCGTGCAGATCA Chr9:21151515..21151534 59.97 50
upstream ENSMUSE00000638347 Chr9:21152327..21152430 GCTGCTTCTGGTGCCTAGAG Chr9:21152372..21152391 60.3 60
upstream ENSMUSE00000638345 Chr9:21152519..21152592 AGGAATGCCTTCTTCCTGCT Chr9:21152555..21152574 60.35 50
upstream ENSMUSE00000638344 Chr9:21152772..21152842 TGGGCAAACTTCTGATTGTG Chr9:21152813..21152832 59.69 45
upstream ENSMUSE00000638343 Chr9:21152982..21153070 CGGATCAGAATTGTGCAAGA Chr9:21153011..21153030 59.8 45
upstream ENSMUSE00000638342 Chr9:21156911..21156995 GGACACGCTGTTCCTCTGTT Chr9:21156973..21156992 60.31 55

*** Putative Vector Insertion (Chr 9: 21156996 - 21158125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638341 Chr9:21158126..21159469 ATGCCCCAGTCCTCTAGGTT Chr9:21158390..21158409 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGACCCTGACTTCCTTTTC Chr9:21157026..21157046 59.91 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACCCTGACTTCCTTTTC Chr9:21157026..21157046 59.91 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057193