Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22980
Trapped Gene
D030028A08Rik (ENSMUSG00000078700)
Vector Insertion
Chr 11: 96806408 - 96813894
Public Clones 5SE064H05 (ggtc) 3SE064H05 (ggtc) (ggtc) IST14281H12 (tigm)
Private Clones OST279636 (lexicon) OST109345 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673978 (Chr11:96806159..96806407 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACTTCACGTGGTGGATGT Chr11:96806228..96806247 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673978 (Chr11:96806159..96806407 +)
Downstram Exon
ENSMUSE00000720437 (Chr11:96813895..96814042 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACTTCACGTGGTGGATGT Chr11:96806228..96806247 60.01 50 CTCACACTCCATCCTTGTCG Chr11:96813972..96813991 59.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673973 Chr11:96805479..96805528 GAAGCACGTGGAGGTTTGTT Chr11:96805505..96805524 60.16 50
upstream ENSMUSE00000673979 Chr11:96805503..96805528 GAAGCACGTGGAGGTTTGTT Chr11:96805505..96805524 60.16 50
upstream ENSMUSE00000673978 Chr11:96806159..96806407 TGACTTCACGTGGTGGATGT Chr11:96806228..96806247 60.01 50

*** Putative Vector Insertion (Chr 11: 96806408 - 96813894) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673977 Chr11:96813895..96814042 CTCACACTCCATCCTTGTCG Chr11:96813972..96813991 59.26 55
downstream ENSMUSE00000720437 Chr11:96813895..96814042 CTCACACTCCATCCTTGTCG Chr11:96813972..96813991 59.26 55
downstream ENSMUSE00000673976 Chr11:96820167..96820338 CTCACCACATGCTTCGGATA Chr11:96820300..96820319 59.67 50
downstream ENSMUSE00000673972 Chr11:96820654..96820763 AGGGTGTCTGAGGCTAGCAG Chr11:96820739..96820758 59.62 60
downstream ENSMUSE00000673975 Chr11:96820654..96820765 AGGGTGTCTGAGGCTAGCAG Chr11:96820739..96820758 59.62 60
downstream ENSMUSE00000673974 Chr11:96820868..96821376 AGACAGAGCCCAGTGTTGCT Chr11:96821241..96821260 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGTCTGCAGTGGGAACTC Chr11:96806434..96806454 60.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGTCTGCAGTGGGAACTC Chr11:96806434..96806454 60.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078700