Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22984
Trapped Gene
S100a11 (ENSMUSG00000027907)
Vector Insertion
Chr 3: 93324476 - 93327972
Public Clones (sanger)
Private Clones OST279629 (lexicon) OST265765 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000300903 (Chr3:93324417..93324475 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000300903 (Chr3:93324417..93324475 +)
Downstram Exon
ENSMUSE00000174310 (Chr3:93327973..93328121 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTTCCCGCTGTACTTTTGGA Chr3:93328049..93328068 60.24 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000300903 Chr3:93324417..93324475 No primer for this exon

*** Putative Vector Insertion (Chr 3: 93324476 - 93327972) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000174310 Chr3:93327973..93328121 CTTCCCGCTGTACTTTTGGA Chr3:93328049..93328068 60.24 50
downstream ENSMUSE00000174309 Chr3:93329914..93330209 AAGCCACCAATGAGGTTGAG Chr3:93330020..93330039 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCATGCACTGGAGCTATC Chr3:93324473..93324493 59.58 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCATGCACTGGAGCTATC Chr3:93324473..93324493 59.58 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027907