Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22988
Trapped Gene
6430571L13Rik (ENSMUSG00000037977)
Vector Insertion
Chr 9: 107243749 - 107244537
Public Clones not available
Private Clones OST279529 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334534 (Chr9:107243642..107243748 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGGAGGGAAATAGGTGT Chr9:107243723..107243742 60.32 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334534 (Chr9:107243642..107243748 +)
Downstram Exon
ENSMUSE00000391120 (Chr9:107244538..107244920 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGGAGGGAAATAGGTGT Chr9:107243723..107243742 60.32 55 CCCACCGACTTCTGACCTTA Chr9:107244646..107244665 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409523 Chr9:107242971..107243119 GCGGGTCACTACCAACCTTA Chr9:107243062..107243081 59.99 55
upstream ENSMUSE00000334534 Chr9:107243642..107243748 CTCCGGAGGGAAATAGGTGT Chr9:107243723..107243742 60.32 55

*** Putative Vector Insertion (Chr 9: 107243749 - 107244537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391120 Chr9:107244538..107244920 CCCACCGACTTCTGACCTTA Chr9:107244646..107244665 60.1 55
downstream ENSMUSE00000256273 Chr9:107248477..107248502 No primer for this exon
downstream ENSMUSE00000256245 Chr9:107249149..107249296 CTCCAGCTCGTCTTGTTCCT Chr9:107249224..107249243 59.6 55
downstream ENSMUSE00000345002 Chr9:107250276..107252014 AAGCCAATGCAGAAAGCCTA Chr9:107251259..107251278 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCGGAGGGAAATAGGTGT Chr9:107243724..107243744 60.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCGTGCCTTACATCTCGT Chr9:107243783..107243803 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037977