Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22993
Trapped Gene
AC160147.6 (ENSMUSG00000061983)
Vector Insertion
Chr 10: 23505080 - 23505381
Public Clones not available
Private Clones OST279477 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510690 (Chr10:23505382..23505483 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGTTGCAGTTGCGTAGTG Chr10:23505388..23505407 60.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510690 (Chr10:23505382..23505483 -)
Downstram Exon
ENSMUSE00000409210 (Chr10:23505003..23505079 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGTTGCAGTTGCGTAGTG Chr10:23505388..23505407 60.9 50 GATGACATCCTTGGCCTGAG Chr10:23505022..23505041 60.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416964 Chr10:23506962..23507005 No primer for this exon
upstream ENSMUSE00000461522 Chr10:23506800..23506850 No primer for this exon
upstream ENSMUSE00000467687 Chr10:23506570..23506686 AGCTGCTGGAGGTGTAATGG Chr10:23506664..23506683 60.28 55
upstream ENSMUSE00000469732 Chr10:23505708..23505810 TGAGCCCATGTATGTCAAGC Chr10:23505752..23505771 59.68 50
upstream ENSMUSE00000510690 Chr10:23505382..23505483 TTGGTTGCAGTTGCGTAGTG Chr10:23505388..23505407 60.9 50

*** Putative Vector Insertion (Chr 10: 23505080 - 23505381) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409210 Chr10:23505003..23505079 GATGACATCCTTGGCCTGAG Chr10:23505022..23505041 60.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCCTTTAGTGGAAACAC Chr10:23505329..23505349 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061983