Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22994
Trapped Gene
Btk (ENSMUSG00000031264)
Vector Insertion
Chr X: 131100218 - 131103443
Public Clones not available
Private Clones OST279458 (lexicon) OST187504 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207739 (ChrX:131103444..131103512 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGGTTCCCGTACCCATTC ChrX:131103447..131103466 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207739 (ChrX:131103444..131103512 -)
Downstram Exon
ENSMUSE00000207741 (ChrX:131100136..131100217 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGGTTCCCGTACCCATTC ChrX:131103447..131103466 60.05 50 GCTCTTCAGTTGGGGAGAAA ChrX:131100147..131100166 59.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000622602 ChrX:131117550..131117655 CTGGGGAGCTACCTGCATTA ChrX:131117563..131117582 60.23 55
upstream ENSMUSE00000694799 ChrX:131117550..131117667 CTGGGGAGCTACCTGCATTA ChrX:131117563..131117582 60.23 55
upstream ENSMUSE00000694798 ChrX:131112009..131112163 GGATTGCATCCTAAGGAAAGG ChrX:131112029..131112049 59.92 47.62
upstream ENSMUSE00000277353 ChrX:131108456..131108626 CTTCAAGAAGCGCCTGTTTC ChrX:131108506..131108525 60.13 50
upstream ENSMUSE00000712195 ChrX:131108456..131108626 CTTCAAGAAGCGCCTGTTTC ChrX:131108506..131108525 60.13 50
upstream ENSMUSE00000207746 ChrX:131107748..131107846 AAAAATCCCCCACCAGAAAG ChrX:131107758..131107777 60.16 45
upstream ENSMUSE00000207739 ChrX:131103444..131103512 AAAGGTTCCCGTACCCATTC ChrX:131103447..131103466 60.05 50

*** Putative Vector Insertion (Chr X: 131100218 - 131103443) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207741 ChrX:131100136..131100217 GCTCTTCAGTTGGGGAGAAA ChrX:131100147..131100166 59.4 50
downstream ENSMUSE00000277330 ChrX:131093737..131093865 CAAAATTTGGCAGCCCATAG ChrX:131093731..131093750 60.45 45
downstream ENSMUSE00000277322 ChrX:131093226..131093293 GGGAAGAGGCTTTTTCGTTT ChrX:131093225..131093244 59.7 45
downstream ENSMUSE00000207752 ChrX:131091327..131091514 GACCTTTTTCAGCTCGGTTG ChrX:131091424..131091443 59.85 50
downstream ENSMUSE00000207745 ChrX:131090877..131090939 CTTGGGATGTAGCCTTCCTG ChrX:131090897..131090916 59.69 55
downstream ENSMUSE00000207740 ChrX:131090088..131090142 TGACTTCGAGTCATGTGCTTG ChrX:131090091..131090111 60.04 47.62
downstream ENSMUSE00000207736 ChrX:131089228..131089307 CCAGCTTTGCTGGAGTCTCT ChrX:131089242..131089261 59.74 55
downstream ENSMUSE00000694803 ChrX:131089002..131089065 GCGTGGAACACACAACGTAA ChrX:131089000..131089019 60.62 50
downstream ENSMUSE00000207748 ChrX:131088938..131089065 GCGTGGAACACACAACGTAA ChrX:131089000..131089019 60.62 50
downstream ENSMUSE00000207750 ChrX:131085741..131085815 TAGAAGGCGCGTTTTTGTTT ChrX:131085737..131085756 59.89 40
downstream ENSMUSE00000207751 ChrX:131084846..131085017 ATTCATCCTCCGACATGGAA ChrX:131084849..131084868 60.28 45
downstream ENSMUSE00000207743 ChrX:131083954..131084170 AAGGAACTGCTTCGACTCCA ChrX:131083944..131083963 59.99 50
downstream ENSMUSE00000207753 ChrX:131082101..131082165 No primer for this exon
downstream ENSMUSE00000207742 ChrX:131081251..131081369 TTGGAGCCTACAGAGCTGGT ChrX:131081306..131081325 60.01 55
downstream ENSMUSE00000207747 ChrX:131080021..131080178 ATGCCAGATGAGGCCTGTAG ChrX:131080040..131080059 60.24 55
downstream ENSMUSE00000694802 ChrX:131076980..131077346 GTATGCCAGGGAACGAGAGA ChrX:131077086..131077105 60.22 55
downstream ENSMUSE00000368789 ChrX:131076914..131077346 GTATGCCAGGGAACGAGAGA ChrX:131077086..131077105 60.22 55
downstream ENSMUSE00000694797 ChrX:131076909..131077346 GTATGCCAGGGAACGAGAGA ChrX:131077086..131077105 60.22 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATTCCAGGTGAGTCATT ChrX:131103432..131103452 59.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTCGTGACTGGGAAAACC ChrX:131103376..131103396 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031264