Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22997
Trapped Gene
Slain2 (ENSMUSG00000036087)
Vector Insertion
Chr 5: 73306253 - 73332530
Public Clones (cmhd) IST14415B4 (tigm)
Private Clones OST279359 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000544165 (Chr5:73305693..73306252 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGCTGGACGAGGTAGAGC Chr5:73306175..73306194 60.16 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000544165 (Chr5:73305693..73306252 +)
Downstram Exon
ENSMUSE00000544164 (Chr5:73332531..73332679 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGCTGGACGAGGTAGAGC Chr5:73306175..73306194 60.16 60 AAAACTTGCCTGCACCAAAC Chr5:73332611..73332630 60.15 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696301 Chr5:73305612..73306252 CTTGCTGGACGAGGTAGAGC Chr5:73306175..73306194 60.16 60
upstream ENSMUSE00000652816 Chr5:73305677..73305691 No primer for this exon
upstream ENSMUSE00000544165 Chr5:73305693..73306252 CTTGCTGGACGAGGTAGAGC Chr5:73306175..73306194 60.16 60

*** Putative Vector Insertion (Chr 5: 73306253 - 73332530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000544164 Chr5:73332531..73332679 AAAACTTGCCTGCACCAAAC Chr5:73332611..73332630 60.15 45
downstream ENSMUSE00000696300 Chr5:73332531..73332679 AAAACTTGCCTGCACCAAAC Chr5:73332611..73332630 60.15 45
downstream ENSMUSE00000476964 Chr5:73339801..73339965 TGACTATGGGAGGTCGCACT Chr5:73339941..73339960 60.68 55
downstream ENSMUSE00000598473 Chr5:73339801..73339965 TGACTATGGGAGGTCGCACT Chr5:73339941..73339960 60.68 55
downstream ENSMUSE00000486962 Chr5:73346566..73346727 GCGCTAGAATCTGCACATCA Chr5:73346715..73346734 60.13 50
downstream ENSMUSE00000598478 Chr5:73346566..73346727 GCGCTAGAATCTGCACATCA Chr5:73346715..73346734 60.13 50
downstream ENSMUSE00000652814 Chr5:73348532..73348891 AATTTCGAGGCGACTGCTTA Chr5:73348753..73348772 59.98 45
downstream ENSMUSE00000652813 Chr5:73349388..73349525 CAACCTGTGTGCTCGATGTT Chr5:73349444..73349463 59.75 50
downstream ENSMUSE00000230246 Chr5:73357043..73357120 GGAAGCAACTGTTTGGCTTT Chr5:73357103..73357122 59.36 45
downstream ENSMUSE00000652812 Chr5:73365770..73366085 AGGTGAGGAGGTGGTTTGTG Chr5:73365912..73365931 60 55
downstream ENSMUSE00000598474 Chr5:73367236..73369619 CAAACAGAAAAACCGGCAAT Chr5:73369370..73369389 59.97 40
downstream ENSMUSE00000706994 Chr5:73367236..73367302 ACAGCCGTCTTTCCAACTGT Chr5:73367299..73367318 59.77 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr5:73318301..73318321 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCAGACGTGACTGGGAAA Chr5:73318297..73318317 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036087