Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23001
Trapped Gene
Dyrk3 (ENSMUSG00000016526)
Vector Insertion
Chr 1: 133032949 - 133034656
Public Clones IST11940G7 (tigm) IST14142E9 (tigm)
Private Clones OST279247 (lexicon) OST256039 (lexicon) OST168831 (lexicon) OST146821 (lexicon)
OST141280 (lexicon) OST135709 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000539859 (Chr1:133034657..133034811 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000539859 (Chr1:133034657..133034811 -)
Downstram Exon
ENSMUSE00000158951 (Chr1:133032837..133032948 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000539859 Chr1:133034657..133034811 No primer for this exon

*** Putative Vector Insertion (Chr 1: 133032949 - 133034656) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158951 Chr1:133032837..133032948 No primer for this exon
downstream ENSMUSE00000400459 Chr1:133025019..133026822 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr1:133034586..133034606 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTTGTAGCGAAGCCAGCA Chr1:133034797..133034817 61.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 GTCTTGTAGCGAAGCCAGCA Chr1:133034797..133034817 61.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016526