Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2303
Trapped Gene
Msn (ENSMUSG00000031207)
Vector Insertion
Chr X: 93337288 - 93345958
Public Clones AF0021 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000493518 (ChrX:93337204..93337287 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGGAGTTTGCCATTCAG ChrX:93337235..93337254 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000493518 (ChrX:93337204..93337287 +)
Downstram Exon
ENSMUSE00000207294 (ChrX:93345959..93346054 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGGAGTTTGCCATTCAG ChrX:93337235..93337254 60.4 50 ACCAAACTTCCCTCAAACCA ChrX:93345995..93346014 59.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710931 ChrX:93291381..93291582 GGAGTCCTTGCCGAAGTGTA ChrX:93291483..93291502 60.26 55
upstream ENSMUSE00000697235 ChrX:93337142..93337153 No primer for this exon
upstream ENSMUSE00000493518 ChrX:93337204..93337287 AGCTGGAGTTTGCCATTCAG ChrX:93337235..93337254 60.4 50

*** Putative Vector Insertion (Chr X: 93337288 - 93345958) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207294 ChrX:93345959..93346054 ACCAAACTTCCCTCAAACCA ChrX:93345995..93346014 59.42 45
downstream ENSMUSE00000299262 ChrX:93347863..93348137 GACTGGACGGCATAAGAAGC ChrX:93348068..93348087 59.84 55
downstream ENSMUSE00000207277 ChrX:93349634..93349717 CCCACTGGTCCTTGTTGAGT ChrX:93349674..93349693 60 55
downstream ENSMUSE00000207286 ChrX:93350803..93350949 ATGTTGAGACCCAAGGCATC ChrX:93350934..93350953 59.93 50
downstream ENSMUSE00000207281 ChrX:93353186..93353282 TTTGTCAATGGGCTTGATGA ChrX:93353276..93353295 60.05 40
downstream ENSMUSE00000549948 ChrX:93355427..93355590 CTCATGATTTCCCATGCACA ChrX:93355501..93355520 60.48 45
downstream ENSMUSE00000207296 ChrX:93358706..93358836 CCAGCTCACGCTTCTTCTTC ChrX:93358746..93358765 60.28 55
downstream ENSMUSE00000299216 ChrX:93359089..93359249 TTCAGCTTCTTGACGCTCCT ChrX:93359192..93359211 60.28 50
downstream ENSMUSE00000207284 ChrX:93360714..93360806 CCATTCCACAGCCTCACTTT ChrX:93360800..93360819 60.11 50
downstream ENSMUSE00000207278 ChrX:93361264..93361488 GCTCTGCCACATGAGGTGTA ChrX:93361345..93361364 59.86 55
downstream ENSMUSE00000654613 ChrX:93361809..93363892 TCATCAATGCGTTGTTTGGT ChrX:93361960..93361979 59.97 40
downstream ENSMUSE00000710854 ChrX:93361809..93363891 TCATCAATGCGTTGTTTGGT ChrX:93361960..93361979 59.97 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGGTGTTACAGGTTGGA ChrX:93337258..93337278 58.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGGTGTTACAGGTTGGA ChrX:93337258..93337278 58.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031207