Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23032
Trapped Gene
1110037F02Rik (ENSMUSG00000040720)
Vector Insertion
Chr 4: 11413253 - 11421910
Public Clones not available
Private Clones OST278488 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000357176 (Chr4:11413105..11413252 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000357176 (Chr4:11413105..11413252 +)
Downstram Exon
ENSMUSE00000411884 (Chr4:11421911..11422026 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60 GCCACTATGGGCTCGTACTC Chr4:11422006..11422025 59.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357176 Chr4:11413105..11413252 CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60
upstream ENSMUSE00000721837 Chr4:11413105..11413252 CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60

*** Putative Vector Insertion (Chr 4: 11413253 - 11421910) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411884 Chr4:11421911..11422026 GCCACTATGGGCTCGTACTC Chr4:11422006..11422025 59.72 60
downstream ENSMUSE00000332299 Chr4:11425887..11425973 TGGAGCACTTGGTTTGCTTA Chr4:11425956..11425975 59.46 45
downstream ENSMUSE00000408877 Chr4:11428456..11428504 No primer for this exon
downstream ENSMUSE00000371066 Chr4:11432589..11432757 TCCATATATTGCCAGGGTCAG Chr4:11432653..11432673 59.79 47.62
downstream ENSMUSE00000243600 Chr4:11434101..11434223 ACATAGGGTCGTCCTCATCG Chr4:11434217..11434236 59.95 55
downstream ENSMUSE00000345092 Chr4:11435054..11435326 TCTTCTTGCGGTTCCTCTTC Chr4:11435189..11435208 59.55 50
downstream ENSMUSE00000409119 Chr4:11440175..11441315 GGCTGTCGAAAGGCTACTTG Chr4:11440640..11440659 60.01 55
downstream ENSMUSE00000391429 Chr4:11443976..11444125 TGGAGTAGCTGATGGCTGTG Chr4:11444035..11444054 60.01 55
downstream ENSMUSE00000406656 Chr4:11446073..11446561 AAAACATCCTTCGTGGCTTG Chr4:11446177..11446196 60.11 45
downstream ENSMUSE00000243482 Chr4:11448252..11448406 GATGCTGCGTGCTGTTCTAA Chr4:11448362..11448381 60.17 50
downstream ENSMUSE00000348692 Chr4:11450000..11450082 TTCAAGCCATTTGCCAAGTT Chr4:11450022..11450041 60.62 40
downstream ENSMUSE00000676263 Chr4:11453494..11453587 GTGGTGGACATGCCACATTA Chr4:11453578..11453597 60.25 50
downstream ENSMUSE00000386237 Chr4:11453742..11454286 TCTTCCGAGATCGTGAGCTT Chr4:11454150..11454169 60.1 50
downstream ENSMUSE00000633428 Chr4:11453742..11454768 CACACTTCCAACTCGCTTCA Chr4:11454445..11454464 60.03 50
downstream ENSMUSE00000243465 Chr4:11454795..11455030 CTCCACAATTTTCGGGTGTT Chr4:11454850..11454869 59.83 45
downstream ENSMUSE00000243457 Chr4:11455685..11455937 TGCTGGCGAGTAACACTGTC Chr4:11455894..11455913 60.06 55
downstream ENSMUSE00000243449 Chr4:11457975..11458192 TCCATAATCGTGCTCTGCAA Chr4:11458178..11458197 60.37 45
downstream ENSMUSE00000243445 Chr4:11461336..11461468 ACCACTCGCTTCAGCAAACT Chr4:11461389..11461408 60.06 50
downstream ENSMUSE00000397336 Chr4:11467057..11467209 GCAGCGTTAAGACTCATCGTC Chr4:11467135..11467155 60.04 52.38
downstream ENSMUSE00000243434 Chr4:11467628..11467788 CTCACCAGATGACTCCAGCA Chr4:11467714..11467733 59.98 55
downstream ENSMUSE00000243429 Chr4:11469254..11469350 TCCATGACATCAGCCAACAC Chr4:11469286..11469305 60.54 50
downstream ENSMUSE00000349590 Chr4:11471978..11472144 TGCTTATGCTTCCCGAGTTT Chr4:11472126..11472145 59.85 45
downstream ENSMUSE00000177290 Chr4:11473116..11473447 GAAAATCCACCACGAGAGGA Chr4:11473382..11473401 60.05 50
downstream ENSMUSE00000177289 Chr4:11475878..11476021 CAACTCGAGCCTCTTGTTCC Chr4:11475920..11475939 59.99 55
downstream ENSMUSE00000605433 Chr4:11476692..11478290 TGAGGAAACAGCGACATCTG Chr4:11477508..11477527 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGGAAAAGAGAGCGTCTG Chr4:11416263..11416283 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGGAAAAGAGAGCGTCTG Chr4:11416263..11416283 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040720