Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23051
Trapped Gene
Zfp524 (ENSMUSG00000051184)
Vector Insertion
Chr 7: 4967163 - 4969038
Public Clones IST14991A4 (tigm) IST15047D2 (tigm) IST15047D2 (tigm) IST12284A1 (tigm)
IST15018G5 (tigm) IST12284A1 (tigm) IST14514F11 (tigm) IST13889F12 (tigm)
IST14514F11 (tigm) IST14620E3 (tigm) IST14203C9 (tigm) IST11653B2 (tigm)
IST14991A4 (tigm) IST12285H1 (tigm) IST14853F12 (tigm) IST13671G7 (tigm)
IST12285H1 (tigm)
Private Clones OST278117 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000364809 (Chr7:4967103..4967162 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000364809 (Chr7:4967103..4967162 +)
Downstram Exon
ENSMUSE00000538365 (Chr7:4969039..4970088 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AACCCAGACAGGGGAGAAGT Chr7:4969897..4969916 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000364809 Chr7:4967103..4967162 No primer for this exon

*** Putative Vector Insertion (Chr 7: 4967163 - 4969038) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000538365 Chr7:4969039..4970088 AACCCAGACAGGGGAGAAGT Chr7:4969897..4969916 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAAATGAGGTACCCAGAG Chr7:4967154..4967174 58.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAAATGAGGTACCCAGAG Chr7:4967154..4967174 58.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051184