Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23069
Trapped Gene
Mrps35 (ENSMUSG00000040112)
Vector Insertion
Chr 6: 146994671 - 146996655
Public Clones not available
Private Clones OST277441 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000277316 (Chr6:146994633..146994670 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGGCCGATGAGGAGAAAG Chr6:146994651..146994670 60.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000277316 (Chr6:146994633..146994670 +)
Downstram Exon
ENSMUSE00000277307 (Chr6:146996656..146996823 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGGCCGATGAGGAGAAAG Chr6:146994651..146994670 60.7 50 CCCATTCGAACAGGTAGAGG Chr6:146996768..146996787 59.54 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340156 Chr6:146991293..146991422 GGCTCGCCGTCCTTTATCAT Chr6:146991299..146991318 63.58 55
upstream ENSMUSE00000277316 Chr6:146994633..146994670 AAAGGCCGATGAGGAGAAAG Chr6:146994651..146994670 60.7 50

*** Putative Vector Insertion (Chr 6: 146994671 - 146996655) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277307 Chr6:146996656..146996823 CCCATTCGAACAGGTAGAGG Chr6:146996768..146996787 59.54 55
downstream ENSMUSE00000277301 Chr6:146998350..146998410 GCCTTTTAATTGCCACAGGA Chr6:146998395..146998414 60.07 45
downstream ENSMUSE00000277295 Chr6:147004374..147004513 TAGATGGTCCCGATGACACA Chr6:147004481..147004500 59.92 50
downstream ENSMUSE00000277287 Chr6:147008664..147008773 CTTGCAGTACCGCTCTCCTA Chr6:147008744..147008763 58.28 55
downstream ENSMUSE00000277277 Chr6:147009945..147010014 AGTCACAGTTCTGCCGCTTC Chr6:147009976..147009995 60.6 55
downstream ENSMUSE00000277269 Chr6:147019076..147019420 TTTGCCCACACATACTCGTC Chr6:147019140..147019159 59.57 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTTCTGAAGCCCTAATCG Chr6:146994708..146994728 58.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGGCCGATGAGGAGAAAG Chr6:146994652..146994672 60.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040112