Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23085
Trapped Gene
Gpr175 (ENSMUSG00000002871)
Vector Insertion
Chr 6: 88852525 - 88855942
Public Clones not available
Private Clones OST276949 (lexicon) OST234741 (lexicon) OST191632 (lexicon) OST186852 (lexicon)
OST89851 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000484694 (Chr6:88852245..88852524 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000484694 (Chr6:88852245..88852524 +)
Downstram Exon
ENSMUSE00000464454 (Chr6:88855943..88856072 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000484694 Chr6:88852245..88852524 No primer for this exon

*** Putative Vector Insertion (Chr 6: 88852525 - 88855942) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464454 Chr6:88855943..88856072 No primer for this exon
downstream ENSMUSE00000321094 Chr6:88857935..88858066 No primer for this exon
downstream ENSMUSE00000194983 Chr6:88858178..88858310 No primer for this exon
downstream ENSMUSE00000194984 Chr6:88859284..88859370 No primer for this exon
downstream ENSMUSE00000194989 Chr6:88859502..88859574 No primer for this exon
downstream ENSMUSE00000194985 Chr6:88859675..88859754 No primer for this exon
downstream ENSMUSE00000194982 Chr6:88860145..88860255 No primer for this exon
downstream ENSMUSE00000194988 Chr6:88860335..88860395 No primer for this exon
downstream ENSMUSE00000194980 Chr6:88860542..88860644 No primer for this exon
downstream ENSMUSE00000194981 Chr6:88860791..88860871 No primer for this exon
downstream ENSMUSE00000558302 Chr6:88861677..88862234 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAAGCTAGCGAGGAGGTAA Chr6:88855559..88855579 59.61 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGTCCTCATCTCCTGCTC Chr6:88855537..88855557 60.1 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002871