Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23091
Trapped Gene
Acp5 (ENSMUSG00000001348)
Vector Insertion
Chr 9: 21934103 - 21934306
Public Clones not available
Private Clones OST276735 (lexicon) OST98318 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217906 (Chr9:21934307..21934573 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217906 (Chr9:21934307..21934573 -)
Downstram Exon
ENSMUSE00000217900 (Chr9:21933975..21934102 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702450 Chr9:21936181..21936259 No primer for this exon
upstream ENSMUSE00000702441 Chr9:21934967..21935098 No primer for this exon
upstream ENSMUSE00000217906 Chr9:21934307..21934573 No primer for this exon

*** Putative Vector Insertion (Chr 9: 21934103 - 21934306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217900 Chr9:21933975..21934102 No primer for this exon
downstream ENSMUSE00000217902 Chr9:21932119..21932464 No primer for this exon
downstream ENSMUSE00000702440 Chr9:21931190..21931706 No primer for this exon
downstream ENSMUSE00000638189 Chr9:21931175..21931706 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGGGTCAGAGGTGACAG Chr9:21934272..21934292 60.46 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGGGTCAGAGGTGACAG Chr9:21934272..21934292 60.46 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001348