Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23094
Trapped Gene
Pcolce (ENSMUSG00000029718)
Vector Insertion
Chr 5: 138048773 - 138049182
Public Clones not available
Private Clones OST276662 (lexicon) OST256277 (lexicon) OST252718 (lexicon) OST148094 (lexicon)
OST106827 (lexicon) OST100993 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000192041 (Chr5:138049183..138049307 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTTCCTGGCACATCATTG Chr5:138049197..138049216 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000192041 (Chr5:138049183..138049307 -)
Downstram Exon
ENSMUSE00000192038 (Chr5:138048636..138048772 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTTCCTGGCACATCATTG Chr5:138049197..138049216 60.11 50 CGTCACTCACAGCTCCGTTA Chr5:138048657..138048676 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514567 Chr5:138052465..138052604 CAGACCCCCAACTACACGAG Chr5:138052465..138052484 60.56 60
upstream ENSMUSE00000648646 Chr5:138052465..138052632 CAGACCCCCAACTACACGAG Chr5:138052465..138052484 60.56 60
upstream ENSMUSE00000192035 Chr5:138051625..138051733 AGGTTACGTGGCAAGTGAGG Chr5:138051675..138051694 60.17 55
upstream ENSMUSE00000192034 Chr5:138050119..138050377 GCTACGATGCTCTGGAGGTC Chr5:138050291..138050310 59.98 60
upstream ENSMUSE00000686275 Chr5:138049845..138049919 No primer for this exon
upstream ENSMUSE00000192041 Chr5:138049183..138049307 CTGTTCCTGGCACATCATTG Chr5:138049197..138049216 60.11 50

*** Putative Vector Insertion (Chr 5: 138048773 - 138049182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192038 Chr5:138048636..138048772 CGTCACTCACAGCTCCGTTA Chr5:138048657..138048676 60.05 55
downstream ENSMUSE00000192039 Chr5:138048055..138048335 TCTGCAGGTTGGGATTTAGG Chr5:138048080..138048099 60.07 50
downstream ENSMUSE00000192036 Chr5:138046951..138047028 CCTGACCGCTTGTACTGCTT Chr5:138046964..138046983 60.45 55
downstream ENSMUSE00000192037 Chr5:138046685..138046855 GCAGGGCACATACAACTTCA Chr5:138046688..138046707 59.72 50
downstream ENSMUSE00000590805 Chr5:138046336..138046545 CCTAGGTTGGGAGGGACACT Chr5:138046381..138046400 60.36 60
downstream ENSMUSE00000345501 Chr5:138046335..138046545 CCTAGGTTGGGAGGGACACT Chr5:138046381..138046400 60.36 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACATCATTGCACCCTCAAA Chr5:138049185..138049205 60.52 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACATCATTGCACCCTCAAA Chr5:138049185..138049205 60.52 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029718