Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2310
Trapped Gene
Nola2 (ENSMUSG00000001056)
Vector Insertion
Chr 11: 51436093 - 51436593
Public Clones AE0771 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103695 (Chr11:51435987..51436092 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103695 (Chr11:51435987..51436092 +)
Downstram Exon
ENSMUSE00000294609 (Chr11:51436594..51436931 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000364720 Chr11:51433288..51433479 No primer for this exon
upstream ENSMUSE00000502326 Chr11:51433584..51433653 No primer for this exon
upstream ENSMUSE00000103695 Chr11:51435987..51436092 No primer for this exon

*** Putative Vector Insertion (Chr 11: 51436093 - 51436593) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294609 Chr11:51436594..51436931 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGAACTTGCCCTACGTCT Chr11:51436057..51436077 59.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGAACTTGCCCTACGTCT Chr11:51436057..51436077 59.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001056