Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23119
Trapped Gene
Gfod2 (ENSMUSG00000013150)
Vector Insertion
Chr 8: 108241551 - 108251887
Public Clones IST14740E8 (tigm) IST13091A12 (tigm) IST13693B11 (tigm) IST12466A12 (tigm)
IST12122C4 (tigm) IST13091A12 (tigm) IST13852D4 (tigm) IST12466A12 (tigm)
Private Clones OST275800 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214439 (Chr8:108251888..108252231 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214439 (Chr8:108251888..108252231 -)
Downstram Exon
ENSMUSE00000606011 (Chr8:108240013..108241550 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214437 Chr8:108282354..108282507 No primer for this exon
upstream ENSMUSE00000214439 Chr8:108251888..108252231 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108241551 - 108251887) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000606011 Chr8:108240013..108241550 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACATAGTCTCTCTGGCTCTGT Chr8:108248912..108248935 59.95 52.17 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACATAGTCTCTCTGGCTCTG Chr8:108248913..108248935 59.11 54.54 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAACCTTGCCTGTTGTGGAC Chr8:108249238..108249258 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAACCTTGCCTGTTGTGGAC Chr8:108249238..108249258 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013150