Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23123
Trapped Gene
Homer3 (ENSMUSG00000003573)
Vector Insertion
Chr 8: 72809450 - 72809829
Public Clones not available
Private Clones OST275712 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000233397 (Chr8:72809293..72809449 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000233397 (Chr8:72809293..72809449 +)
Downstram Exon
ENSMUSE00000213842 (Chr8:72809830..72809961 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434250 Chr8:72806949..72806999 No primer for this exon
upstream ENSMUSE00000331906 Chr8:72809133..72809214 No primer for this exon
upstream ENSMUSE00000233397 Chr8:72809293..72809449 No primer for this exon

*** Putative Vector Insertion (Chr 8: 72809450 - 72809829) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213842 Chr8:72809830..72809961 No primer for this exon
downstream ENSMUSE00000636385 Chr8:72810195..72810260 No primer for this exon
downstream ENSMUSE00000213833 Chr8:72813293..72813400 No primer for this exon
downstream ENSMUSE00000213840 Chr8:72813951..72814072 No primer for this exon
downstream ENSMUSE00000213835 Chr8:72814906..72815062 No primer for this exon
downstream ENSMUSE00000213838 Chr8:72815217..72815327 No primer for this exon
downstream ENSMUSE00000682845 Chr8:72815416..72815502 No primer for this exon
downstream ENSMUSE00000213836 Chr8:72815425..72815502 No primer for this exon
downstream ENSMUSE00000461102 Chr8:72816874..72818249 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTACCGCATCATCAGCATC Chr8:72809419..72809439 60.66 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTACCGCATCATCAGCATC Chr8:72809419..72809439 60.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003573