Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23131
Trapped Gene
Nip7 (ENSMUSG00000031917)
Vector Insertion
Chr 8: 109582088 - 109582276
Public Clones not available
Private Clones OST275444 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214633 (Chr8:109581947..109582087 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTCTGGGTCGAATTACTG Chr8:109582012..109582031 60.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214633 (Chr8:109581947..109582087 +)
Downstram Exon
ENSMUSE00000214636 (Chr8:109582277..109582937 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTCTGGGTCGAATTACTG Chr8:109582012..109582031 60.51 55 CCTGTTTTCACGCCATTTCT Chr8:109582534..109582553 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214634 Chr8:109580790..109580890 AGATGAGGCCCTTGACTGAA Chr8:109580833..109580852 59.8 50
upstream ENSMUSE00000214640 Chr8:109580993..109581079 CTGCACAACGACCGAGTGTA Chr8:109581051..109581070 60.93 55
upstream ENSMUSE00000214638 Chr8:109581173..109581311 GGACGTGTTTTGGGAAGTTT Chr8:109581229..109581248 58.93 45
upstream ENSMUSE00000214633 Chr8:109581947..109582087 CGGTCTGGGTCGAATTACTG Chr8:109582012..109582031 60.51 55

*** Putative Vector Insertion (Chr 8: 109582088 - 109582276) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214636 Chr8:109582277..109582937 CCTGTTTTCACGCCATTTCT Chr8:109582534..109582553 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATGCCAGGTACCCACTGT Chr8:109582120..109582140 59.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGACATTCCTCTGGTGAGT Chr8:109582075..109582095 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031917