Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23132
Trapped Gene
Tbc1d24 (ENSMUSG00000036473)
Vector Insertion
Chr 17: 24323233 - 24326888
Public Clones not available
Private Clones OST275433 (lexicon) OST209112 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000397195 (Chr17:24326889..24326998 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAAGTGGACCCCTGTGAC Chr17:24326923..24326942 60.56 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000397195 (Chr17:24326889..24326998 -)
Downstram Exon
ENSMUSE00000475486 (Chr17:24322149..24323232 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAAGTGGACCCCTGTGAC Chr17:24326923..24326942 60.56 60 TCAGGCAAGGGCAGACTACT Chr17:24322811..24322830 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482671 Chr17:24342419..24342505 GAAAGTCCAGTGCGGTCCAG Chr17:24342458..24342477 63.14 60
upstream ENSMUSE00000397195 Chr17:24326889..24326998 CTGAAGTGGACCCCTGTGAC Chr17:24326923..24326942 60.56 60

*** Putative Vector Insertion (Chr 17: 24323233 - 24326888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000475486 Chr17:24322149..24323232 TCAGGCAAGGGCAGACTACT Chr17:24322811..24322830 60.01 55
downstream ENSMUSE00000658078 Chr17:24321326..24321343 No primer for this exon
downstream ENSMUSE00000401365 Chr17:24320639..24320797 AGGGATCCAGGACCAAATGT Chr17:24320685..24320704 60.58 50
downstream ENSMUSE00000309806 Chr17:24319731..24319794 GGGCTCATGTCCTTCACACT Chr17:24319742..24319761 60.12 55
downstream ENSMUSE00000309780 Chr17:24319395..24319490 GTCCTCTCGCTCCAGTCTGT Chr17:24319428..24319447 59.58 60
downstream ENSMUSE00000309759 Chr17:24318701..24318929 ACTTGAGGGATGTTGCCTTG Chr17:24318832..24318851 60.11 50
downstream ENSMUSE00000612131 Chr17:24318170..24318340 ACAGCTGCGATGAGGAAGTT Chr17:24318201..24318220 60.02 50
downstream ENSMUSE00000658081 Chr17:24312377..24317621 GACTCAGAACGGAGGCAGTC Chr17:24316239..24316258 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTGAATACTGGGCTTGT Chr17:24326851..24326871 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTGAATACTGGGCTTGT Chr17:24326851..24326871 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036473