Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23140
Trapped Gene
Ccnb1 (ENSMUSG00000041431)
Vector Insertion
Chr 13: 101555859 - 101556336
Public Clones not available
Private Clones OST275233 (lexicon) OST266114 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679930 (Chr13:101556337..101556451 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGGGGAACCTCTGATTTT Chr13:101556367..101556386 59.77 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679930 (Chr13:101556337..101556451 -)
Downstram Exon
ENSMUSE00000506016 (Chr13:101555688..101555858 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGGGGAACCTCTGATTTT Chr13:101556367..101556386 59.77 45 GAGGCACTCTTGCCTGTAGC Chr13:101555674..101555693 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679930 Chr13:101556337..101556451 ATCGGGGAACCTCTGATTTT Chr13:101556367..101556386 59.77 45

*** Putative Vector Insertion (Chr 13: 101555859 - 101556336) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506016 Chr13:101555688..101555858 GAGGCACTCTTGCCTGTAGC Chr13:101555674..101555693 60.16 60
downstream ENSMUSE00000492616 Chr13:101555412..101555573 CAGCAAGTTCCACCTCTGGT Chr13:101555455..101555474 60.3 55
downstream ENSMUSE00000491666 Chr13:101553420..101553602 GCGTCTACGTCACTCACTGC Chr13:101553471..101553490 59.65 60
downstream ENSMUSE00000518252 Chr13:101551580..101551738 GCATGAACCGATCAATAATGG Chr13:101551560..101551580 60.17 42.86
downstream ENSMUSE00000520226 Chr13:101551113..101551349 GCTCTACGGAGGAAGTGCAG Chr13:101551107..101551126 60.16 60
downstream ENSMUSE00000519338 Chr13:101550731..101550871 GCAAAATGCACCATGTCGTA Chr13:101550773..101550792 60.53 45
downstream ENSMUSE00000496967 Chr13:101549977..101550087 CAGGTGCTGCATAACAGGAA Chr13:101550000..101550019 59.86 50
downstream ENSMUSE00000569255 Chr13:101548702..101549740 ACTTGGGGGCAAATTCTTTT Chr13:101549112..101549131 59.81 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCGGGGAACCTCTGATTTT Chr13:101556365..101556385 59.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCGGGGAACCTCTGATTTT Chr13:101556365..101556385 59.77 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041431