Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23151
Trapped Gene
Scyl3 (ENSMUSG00000026584)
Vector Insertion
Chr 1: 165860318 - 165863609
Public Clones (sanger)
Private Clones OST274746 (lexicon) OST90598 (lexicon) OST65842 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361009 (Chr1:165859921..165860317 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAAAGCGGCTGGTTAAAAA Chr1:165859932..165859951 60.23 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361009 (Chr1:165859921..165860317 +)
Downstram Exon
ENSMUSE00000160744 (Chr1:165863610..165863824 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAAAGCGGCTGGTTAAAAA Chr1:165859932..165859951 60.23 40 AAACACGGAAGCACATTTCC Chr1:165863782..165863801 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361009 Chr1:165859921..165860317 CAAAAGCGGCTGGTTAAAAA Chr1:165859932..165859951 60.23 40

*** Putative Vector Insertion (Chr 1: 165860318 - 165863609) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160744 Chr1:165863610..165863824 AAACACGGAAGCACATTTCC Chr1:165863782..165863801 59.98 45
downstream ENSMUSE00000160749 Chr1:165864763..165864948 CAAGGGTGACGGAGTGTCTT Chr1:165864791..165864810 60.15 55
downstream ENSMUSE00000160748 Chr1:165866549..165866662 CAGACGACAGGCAGACATTG Chr1:165866588..165866607 60.46 55
downstream ENSMUSE00000160747 Chr1:165868871..165868927 GAATGGATGCTGGGTCTCTT Chr1:165868916..165868935 59.09 50
downstream ENSMUSE00000160746 Chr1:165870012..165870114 CATTGAAGATGGGGAGCAAG Chr1:165870111..165870130 60.59 50
downstream ENSMUSE00000160745 Chr1:165871238..165871349 CATGGGACAGTAAGGTGCTG Chr1:165871342..165871361 59.16 55
downstream ENSMUSE00000160750 Chr1:165873955..165874032 No primer for this exon
downstream ENSMUSE00000160753 Chr1:165874927..165875066 GCAGAAGAGGCACCAATCTT Chr1:165874997..165875016 59.43 50
downstream ENSMUSE00000160756 Chr1:165876295..165876479 ATCACTCGGGACTGGAACAG Chr1:165876358..165876377 60.11 55
downstream ENSMUSE00000160754 Chr1:165879273..165879444 GGTATCACGAAGGCCCAGTA Chr1:165879299..165879318 59.96 55
downstream ENSMUSE00000160751 Chr1:165880699..165880857 CTTTTGAGACCCGACTCTGC Chr1:165880749..165880768 59.99 55
downstream ENSMUSE00000160752 Chr1:165882068..165882747 CCTTGTCAGGGACCATCACT Chr1:165882691..165882710 59.96 55
downstream ENSMUSE00000160757 Chr1:165883513..165885241 CTTGGCACAGACTGCAAAAA Chr1:165883699..165883718 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr1:165860369..165860389 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTGTACGATTGGGTTTGG Chr1:165860346..165860366 59.29 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026584