Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23152
Trapped Gene
2210018M11Rik (ENSMUSG00000035401)
Vector Insertion
Chr 7: 105803363 - 105804983
Public Clones PST17314-NR (escells)
Private Clones OST274740 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000590492 (Chr7:105804984..105805079 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACCGCAAACAAACCTAAT Chr7:105805045..105805064 60 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000590492 (Chr7:105804984..105805079 -)
Downstram Exon
ENSMUSE00000672146 (Chr7:105803254..105803362 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACCGCAAACAAACCTAAT Chr7:105805045..105805064 60 45 TTTTCGAAGAATCCGTTTGC Chr7:105803236..105803255 60.19 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590492 Chr7:105804984..105805079 GCACCGCAAACAAACCTAAT Chr7:105805045..105805064 60 45

*** Putative Vector Insertion (Chr 7: 105803363 - 105804983) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672146 Chr7:105803254..105803362 TTTTCGAAGAATCCGTTTGC Chr7:105803236..105803255 60.19 40
downstream ENSMUSE00000265873 Chr7:105796315..105796414 CTCCAGCATATGCCTCCAGT Chr7:105796372..105796391 60.24 55
downstream ENSMUSE00000265867 Chr7:105794959..105795033 ACTGCTCTCCGAACTTCAGC Chr7:105794970..105794989 59.75 55
downstream ENSMUSE00000367767 Chr7:105793677..105793718 No primer for this exon
downstream ENSMUSE00000265864 Chr7:105790003..105790178 CTGGGCATCAGAGGTACCAA Chr7:105790088..105790107 61.06 55
downstream ENSMUSE00000337067 Chr7:105785771..105786030 CACAGGCACAGTGATCGTCT Chr7:105785875..105785894 59.9 55
downstream ENSMUSE00000380429 Chr7:105778641..105778917 ACGGACGGTGTGGAAGATAC Chr7:105778642..105778661 59.85 55
downstream ENSMUSE00000371161 Chr7:105774976..105775230 CTGGGTAGGGCCACTCACTA Chr7:105775132..105775151 60.13 60
downstream ENSMUSE00000414241 Chr7:105769901..105770050 TTGGGGAATTGCTACTGGTG Chr7:105769939..105769958 60.88 50
downstream ENSMUSE00000366705 Chr7:105767809..105767979 AGCCACACGACCTAAGGATG Chr7:105767902..105767921 60.13 55
downstream ENSMUSE00000590491 Chr7:105763986..105764122 CATTGGGCTTGGAAGTCATT Chr7:105764053..105764072 59.93 45
downstream ENSMUSE00000529351 Chr7:105761494..105761667 CTGCGGAACCTATTCCTTTG Chr7:105761534..105761553 59.7 50
downstream ENSMUSE00000529349 Chr7:105759177..105759375 CATCTGCTACCCTGGATGCT Chr7:105759248..105759267 60.24 55
downstream ENSMUSE00000529335 Chr7:105751093..105751257 TGTTCTGACCAATCCTGACG Chr7:105751181..105751200 59.68 50
downstream ENSMUSE00000590490 Chr7:105749182..105749337 CTACCACAGCAATGGATGGA Chr7:105749193..105749212 59.52 50
downstream ENSMUSE00000633473 Chr7:105748262..105748303 AGGGGAAAAGCAACCTCTGT Chr7:105748245..105748264 60.11 50
downstream ENSMUSE00000486627 Chr7:105745543..105745694 CATGATGTGGGTGATTGCTC Chr7:105745527..105745546 59.92 50
downstream ENSMUSE00000351526 Chr7:105743262..105743822 TCGTAAAAGCGGTGTGACTG Chr7:105743773..105743792 59.9 50
downstream ENSMUSE00000265941 Chr7:105741841..105742320 TGTTGGGCTCTCTTCAGCTT Chr7:105741834..105741853 60.13 50
downstream ENSMUSE00000379916 Chr7:105739125..105739394 GGTAACCACGCAGGCTCTAA Chr7:105739136..105739155 60.27 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCAGGCTATCCAGGTAA Chr7:105804929..105804949 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTAGATGAGCCCCGAAAG Chr7:105804991..105805011 59.29 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCACCGCAAACAAACCTAAT Chr7:105805043..105805063 60 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCACCGCAAACAAACCTAAT Chr7:105805043..105805063 60 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035401