Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23164
Trapped Gene
Ankrd35 (ENSMUSG00000038354)
Vector Insertion
Chr 3: 96493434 - 96494114
Public Clones not available
Private Clones OST274288 (lexicon) OST195744 (lexicon) OST87706 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248237 (Chr3:96493368..96493433 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCCAGAAGAACCACGAAG Chr3:96493370..96493389 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248237 (Chr3:96493368..96493433 +)
Downstram Exon
ENSMUSE00000438379 (Chr3:96494115..96494957 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCCAGAAGAACCACGAAG Chr3:96493370..96493389 59.84 55 TCAGGTCTGGAGTTCGTGTG Chr3:96494872..96494891 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410288 Chr3:96474054..96474372 TAGCCGAGTTGGGTTAGGAA Chr3:96474260..96474279 59.7 50
upstream ENSMUSE00000370295 Chr3:96482056..96482186 AGAAATGGAACCGACGTGAT Chr3:96482060..96482079 59.41 45
upstream ENSMUSE00000397790 Chr3:96483103..96483191 CTCCAAAGGCCTGACAGAGT Chr3:96483118..96483137 59.45 55
upstream ENSMUSE00000357628 Chr3:96483553..96483617 CTTCATTTGGCCACCATCTC Chr3:96483564..96483583 60.46 50
upstream ENSMUSE00000346384 Chr3:96484394..96484451 GCAGAAAATCGCAGTCCATT Chr3:96484421..96484440 60.22 45
upstream ENSMUSE00000384381 Chr3:96484550..96484620 TCCTGGACGTGCTGGATAAT Chr3:96484601..96484620 60.48 50
upstream ENSMUSE00000334317 Chr3:96484885..96484991 TGCCCGAGTTAATGTCACAG Chr3:96484959..96484978 59.72 50
upstream ENSMUSE00000369013 Chr3:96485950..96486134 GTTTGGGACACAACGCTCTT Chr3:96486039..96486058 60.16 50
upstream ENSMUSE00000362130 Chr3:96486917..96486954 ACACCCAGATCACCCATCTC Chr3:96486933..96486952 59.77 55
upstream ENSMUSE00000354995 Chr3:96487106..96489097 CGCAAGAACTAGGCCATCTC Chr3:96487341..96487360 59.98 55
upstream ENSMUSE00000248243 Chr3:96493069..96493158 GAGCAGCTTTCGGAAGAAGT Chr3:96493093..96493112 58.82 50
upstream ENSMUSE00000248237 Chr3:96493368..96493433 CTCCCAGAAGAACCACGAAG Chr3:96493370..96493389 59.84 55

*** Putative Vector Insertion (Chr 3: 96493434 - 96494114) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000438379 Chr3:96494115..96494957 TCAGGTCTGGAGTTCGTGTG Chr3:96494872..96494891 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTACAGGGCTGAGGAAGGT Chr3:96493466..96493486 60.51 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGTACAGGGCTGAGGAAG Chr3:96493464..96493484 58.89 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038354