Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23167
Trapped Gene
Pgs1 (ENSMUSG00000017715)
Vector Insertion
Chr 11: 117848328 - 117858754
Public Clones (sanger) D054G04 (ggtc) IST12503D12 (tigm) IST14182G6 (tigm) IST14595F7 (tigm)
IST14182G5 (tigm)
Private Clones OST274215 (lexicon) OST169973 (lexicon) OST68615 (lexicon) OST39597 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000427949 (Chr11:117848171..117848327 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000427949 (Chr11:117848171..117848327 +)
Downstram Exon
ENSMUSE00000367710 (Chr11:117858755..117858944 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427949 Chr11:117848171..117848327 No primer for this exon

*** Putative Vector Insertion (Chr 11: 117848328 - 117858754) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367710 Chr11:117858755..117858944 No primer for this exon
downstream ENSMUSE00000151763 Chr11:117861513..117861590 No primer for this exon
downstream ENSMUSE00000669468 Chr11:117862336..117862347 No primer for this exon
downstream ENSMUSE00000151762 Chr11:117862930..117863029 No primer for this exon
downstream ENSMUSE00000151767 Chr11:117863665..117863854 No primer for this exon
downstream ENSMUSE00000151764 Chr11:117864655..117864833 No primer for this exon
downstream ENSMUSE00000360045 Chr11:117866684..117867205 No primer for this exon
downstream ENSMUSE00000398350 Chr11:117875888..117876036 No primer for this exon
downstream ENSMUSE00000669467 Chr11:117875961..117876036 No primer for this exon
downstream ENSMUSE00000346452 Chr11:117880921..117881046 No primer for this exon
downstream ENSMUSE00000669466 Chr11:117880921..117881046 No primer for this exon
downstream ENSMUSE00000384302 Chr11:117884719..117885325 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGTTCCTTCCCTTTATTCAA Chr11:117854279..117854301 59.61 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGTTCCTTCCCTTTATTCAA Chr11:117854279..117854301 59.61 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017715