Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23171
Trapped Gene
Agrp (ENSMUSG00000005705)
Vector Insertion
Chr 8: 108090839 - 108091019
Public Clones not available
Private Clones OST274062 (lexicon) OST273966 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214388 (Chr8:108091020..108091102 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214388 (Chr8:108091020..108091102 -)
Downstram Exon
ENSMUSE00000214390 (Chr8:108090600..108090838 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000580400 Chr8:108092116..108092198 No primer for this exon
upstream ENSMUSE00000580399 Chr8:108091506..108091626 No primer for this exon
upstream ENSMUSE00000341888 Chr8:108091260..108091392 No primer for this exon
upstream ENSMUSE00000214388 Chr8:108091020..108091102 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108090839 - 108091019) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214390 Chr8:108090600..108090838 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGGCGGAGGTAACTCAT Chr8:108091009..108091029 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGGCGGAGGTAACTCAT Chr8:108091009..108091029 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005705