Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23175
Trapped Gene
Ube2l6 (ENSMUSG00000027078)
Vector Insertion
Chr 2: 84639090 - 84642935
Public Clones not available
Private Clones OST273861 (lexicon) OST178763 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721893 (Chr2:84638996..84639089 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTTCAGAGAGCGGTGTCCT Chr2:84639007..84639026 59.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721893 (Chr2:84638996..84639089 +)
Downstram Exon
ENSMUSE00000235673 (Chr2:84642936..84643031 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTTCAGAGAGCGGTGTCCT Chr2:84639007..84639026 59.05 55 GACAGTTGGCGAAGGTATGG Chr2:84642988..84643007 60.52 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389304 Chr2:84638996..84639089 AGTTCAGAGAGCGGTGTCCT Chr2:84639007..84639026 59.05 55
upstream ENSMUSE00000721893 Chr2:84638996..84639089 AGTTCAGAGAGCGGTGTCCT Chr2:84639007..84639026 59.05 55

*** Putative Vector Insertion (Chr 2: 84639090 - 84642935) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235673 Chr2:84642936..84643031 GACAGTTGGCGAAGGTATGG Chr2:84642988..84643007 60.52 55
downstream ENSMUSE00000688579 Chr2:84643585..84643677 GCTGGCTGGTTAGCCTGTCT Chr2:84643636..84643655 61.88 60
downstream ENSMUSE00000165867 Chr2:84646494..84646680 GTGGGAGGCTTGAATGGATA Chr2:84646573..84646592 59.89 50
downstream ENSMUSE00000235664 Chr2:84649162..84650333 GCACAGGCTCTTCCAGATTC Chr2:84649218..84649237 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCACATGCTTGTCCTGTCT Chr2:84639117..84639137 60.47 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCACATGCTTGTCCTGTCT Chr2:84639117..84639137 60.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027078