Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23176
Trapped Gene
Scn5a (ENSMUSG00000032511)
Vector Insertion
Chr 9: 119410914 - 119421258
Public Clones not available
Private Clones OST273841 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000265702 (Chr9:119421259..119421413 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACCGCATAGTGGAGCACA Chr9:119421312..119421331 59.89 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000265702 (Chr9:119421259..119421413 -)
Downstram Exon
ENSMUSE00000220326 (Chr9:119410740..119410913 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACCGCATAGTGGAGCACA Chr9:119421312..119421331 59.89 55 CGCTCCTCCAGGTAGATGTC Chr9:119410863..119410882 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633667 Chr9:119487967..119488134 No primer for this exon
upstream ENSMUSE00000472419 Chr9:119471470..119471796 TACAGGCCTCCAAAAAGCTG Chr9:119471551..119471570 60.38 50
upstream ENSMUSE00000717797 Chr9:119471470..119471796 TACAGGCCTCCAAAAAGCTG Chr9:119471551..119471570 60.38 50
upstream ENSMUSE00000718764 Chr9:119469380..119469498 CAATGCCTTGTACGTCCTCA Chr9:119469429..119469448 59.72 50
upstream ENSMUSE00000528326 Chr9:119469379..119469498 CAATGCCTTGTACGTCCTCA Chr9:119469429..119469448 59.72 50
upstream ENSMUSE00000266128 Chr9:119461104..119461192 CATGTGCACCATCCTAACCA Chr9:119461156..119461175 60.39 50
upstream ENSMUSE00000720947 Chr9:119461104..119461193 CATGTGCACCATCCTAACCA Chr9:119461156..119461175 60.39 50
upstream ENSMUSE00000528324 Chr9:119459724..119459852 CTTCACCGCCATCTACACCT Chr9:119459827..119459846 60.13 55
upstream ENSMUSE00000633663 Chr9:119452442..119452533 TTGTCGGCTCTTCGAACTTT Chr9:119452483..119452502 59.99 45
upstream ENSMUSE00000721793 Chr9:119452217..119452308 GGGCAATGTCTCAGCCTTAC Chr9:119452265..119452284 59.7 55
upstream ENSMUSE00000266070 Chr9:119448642..119448872 CTAGCCGATGTGATGGTCCT Chr9:119448809..119448828 60.1 55
upstream ENSMUSE00000266040 Chr9:119446740..119446803 CCTACTCAAGAATGGCACCAC Chr9:119446776..119446796 59.61 52.38
upstream ENSMUSE00000266013 Chr9:119445558..119445699 ACCACGGTTACACCAGCTTC Chr9:119445633..119445652 60.03 55
upstream ENSMUSE00000265991 Chr9:119444931..119445128 ATGGCTTACGAGGAGCAAAA Chr9:119445010..119445029 59.85 45
upstream ENSMUSE00000331967 Chr9:119443673..119443852 ACTCAGAAGACGGTCCCAGA Chr9:119443679..119443698 59.83 55
upstream ENSMUSE00000367743 Chr9:119442781..119443152 GCAGATTTTGCAGATGACGA Chr9:119443031..119443050 59.96 45
upstream ENSMUSE00000339722 Chr9:119439075..119439207 CATGTGCAGATGGCTTTGAG Chr9:119439136..119439155 60.41 50
upstream ENSMUSE00000265845 Chr9:119438030..119438268 AACACGCTCTTCATGGCTCT Chr9:119438085..119438104 60.02 50
upstream ENSMUSE00000528322 Chr9:119431596..119431769 GGGCTGGAATATCTTCGACA Chr9:119431676..119431695 60.04 50
upstream ENSMUSE00000220327 Chr9:119430132..119430488 ATCATCGGGAACTCTGTTGG Chr9:119430415..119430434 59.93 50
upstream ENSMUSE00000220333 Chr9:119426466..119426909 GATGAGGAGAACAGCCTTGG Chr9:119426494..119426513 59.8 55
upstream ENSMUSE00000265753 Chr9:119425021..119425182 AATCCCAAGTTGTGTCTGGTG Chr9:119425158..119425178 59.88 47.62
upstream ENSMUSE00000717700 Chr9:119425021..119425179 AATCCCAAGTTGTGTCTGGTG Chr9:119425158..119425178 59.88 47.62
upstream ENSMUSE00000220332 Chr9:119422099..119422219 AGACCTCCTGGAGCAAATCC Chr9:119422147..119422166 60.6 55
upstream ENSMUSE00000265702 Chr9:119421259..119421413 CTACCGCATAGTGGAGCACA Chr9:119421312..119421331 59.89 55

*** Putative Vector Insertion (Chr 9: 119410914 - 119421258) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220326 Chr9:119410740..119410913 CGCTCCTCCAGGTAGATGTC Chr9:119410863..119410882 59.83 60
downstream ENSMUSE00000220330 Chr9:119407199..119407321 ATCTCGGCAAAGCCTAAGGT Chr9:119407253..119407272 60.23 50
downstream ENSMUSE00000220329 Chr9:119404625..119404906 GGTTGATGCACCTACCGAAC Chr9:119404752..119404771 60.38 55
downstream ENSMUSE00000528316 Chr9:119402179..119402232 GAGTCCACAGCCGCATACAT Chr9:119402164..119402183 61.1 55
downstream ENSMUSE00000265600 Chr9:119401167..119401304 AAGGAGCCGAAGATGATGAA Chr9:119401206..119401225 59.77 45
downstream ENSMUSE00000496651 Chr9:119400579..119400683 TGCTCCTCCGTCATGAAGAT Chr9:119400627..119400646 60.77 50
downstream ENSMUSE00000528313 Chr9:119398867..119399137 TGACAACCACGAAATCGAAG Chr9:119398860..119398879 59.69 45
downstream ENSMUSE00000719485 Chr9:119393442..119395936 CCGACACCTCCTCATGTTTT Chr9:119395015..119395034 59.97 50
downstream ENSMUSE00000505623 Chr9:119392529..119395936 CCGACACCTCCTCATGTTTT Chr9:119395015..119395034 59.97 50
downstream ENSMUSE00000720589 Chr9:119392528..119395936 CCGACACCTCCTCATGTTTT Chr9:119395015..119395034 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGCATTTTTGTTGGTGT Chr9:119418278..119418298 60.79 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAGGGCTACAAGAAGA Chr9:119418210..119418230 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032511