Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23180
Trapped Gene
Gm920 (ENSMUSG00000075413)
Vector Insertion
Chr 15: 99786091 - 99797180
Public Clones not available
Private Clones OST273618 (lexicon) OST203674 (lexicon) OST200752 (lexicon) OST193053 (lexicon)
OST112279 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000646076 (Chr15:99797181..99797492 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTAACCTCGGGAGTCCTTG Chr15:99797464..99797483 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000646076 (Chr15:99797181..99797492 -)
Downstram Exon
ENSMUSE00000646075 (Chr15:99785874..99786090 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTAACCTCGGGAGTCCTTG Chr15:99797464..99797483 60.1 55 CAGCTCCACGTTGCTCATTA Chr15:99786024..99786043 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646076 Chr15:99797181..99797492 TGTAACCTCGGGAGTCCTTG Chr15:99797464..99797483 60.1 55

*** Putative Vector Insertion (Chr 15: 99786091 - 99797180) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000646075 Chr15:99785874..99786090 CAGCTCCACGTTGCTCATTA Chr15:99786024..99786043 60.01 50
downstream ENSMUSE00000646074 Chr15:99785181..99785351 ATCCTTTTCAGCGTGTCTGG Chr15:99785236..99785255 60.26 50
downstream ENSMUSE00000646072 Chr15:99776152..99778206 CATTACACCAGGCTCCACCT Chr15:99776365..99776384 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGGCCAAAGAGGTGAGTAG Chr15:99788171..99788191 62.08 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTCGTGACTGGGAAAACC Chr15:99791113..99791133 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075413