Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23183
Trapped Gene
Commd2 (ENSMUSG00000036513)
Vector Insertion
Chr 3: 57454696 - 57455343
Public Clones not available
Private Clones OST272910 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000255767 (Chr3:57455344..57455421 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACCCGAAGATCTACGAAGG Chr3:57455352..57455372 59.6 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000255767 (Chr3:57455344..57455421 -)
Downstram Exon
ENSMUSE00000255760 (Chr3:57454613..57454695 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACCCGAAGATCTACGAAGG Chr3:57455352..57455372 59.6 47.62 GCTCTCGGTGAGGAGATACG Chr3:57454603..57454622 59.97 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445127 Chr3:57455509..57455630 GAAGAGCCGCTAAAATGCTG Chr3:57455570..57455589 60.12 50
upstream ENSMUSE00000255767 Chr3:57455344..57455421 AAACCCGAAGATCTACGAAGG Chr3:57455352..57455372 59.6 47.62

*** Putative Vector Insertion (Chr 3: 57454696 - 57455343) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255760 Chr3:57454613..57454695 GCTCTCGGTGAGGAGATACG Chr3:57454603..57454622 59.97 60
downstream ENSMUSE00000255755 Chr3:57453964..57454137 ACATCTAGCCGCCACTCAAG Chr3:57453946..57453965 60.42 55
downstream ENSMUSE00000486679 Chr3:57450283..57450798 GCTTTCCAACCTGCAAGAAG Chr3:57450415..57450434 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGGAGAGTGCGATCTAA Chr3:57455289..57455310 59.73 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTCTGTGGAGCTGGAGA Chr3:57455300..57455320 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036513