Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23187
Trapped Gene
Topbp1 (ENSMUSG00000032555)
Vector Insertion
Chr 9: 103208518 - 103211074
Public Clones not available
Private Clones OST272779 (lexicon) OST252816 (lexicon) OST245667 (lexicon) OST204346 (lexicon)
OST157686 (lexicon) OST35305 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373288 (Chr9:103208427..103208517 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATGACCAAGAGCCGTTTC Chr9:103208442..103208461 59.17 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373288 (Chr9:103208427..103208517 +)
Downstram Exon
ENSMUSE00000319085 (Chr9:103211075..103211209 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATGACCAAGAGCCGTTTC Chr9:103208442..103208461 59.17 45 AGTGCCACTGAAACGGTCAC Chr9:103211191..103211210 61.18 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448198 Chr9:103207545..103207701 GGTTCTGCAGCGTTAGCTTC Chr9:103207562..103207581 60.16 55
upstream ENSMUSE00000373288 Chr9:103208427..103208517 AAATGACCAAGAGCCGTTTC Chr9:103208442..103208461 59.17 45

*** Putative Vector Insertion (Chr 9: 103208518 - 103211074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000319085 Chr9:103211075..103211209 AGTGCCACTGAAACGGTCAC Chr9:103211191..103211210 61.18 55
downstream ENSMUSE00000319054 Chr9:103212147..103212290 TGACCACTTGAGGACCAACA Chr9:103212183..103212202 60.13 50
downstream ENSMUSE00000319015 Chr9:103213824..103214005 TCGTCCACCCATCATTTGTA Chr9:103213865..103213884 59.77 45
downstream ENSMUSE00000448161 Chr9:103215102..103215298 GTGCTTAGCCGTGAGTTGCT Chr9:103215234..103215253 60.6 55
downstream ENSMUSE00000220754 Chr9:103217384..103217560 ATCAGGCACCATCTTTGCTT Chr9:103217529..103217548 59.7 45
downstream ENSMUSE00000220755 Chr9:103220317..103220483 CAGCTGCCATTTATGTTGGA Chr9:103220368..103220387 59.69 45
downstream ENSMUSE00000220757 Chr9:103222499..103222662 ATCGAACTCCACCTCCACTG Chr9:103222577..103222596 60.11 55
downstream ENSMUSE00000220762 Chr9:103222804..103223051 ATCGTGGAGTCGTCATTTCC Chr9:103223052..103223071 59.93 50
downstream ENSMUSE00000318799 Chr9:103225598..103225956 ACAACTTCTCCCACCGTCAC Chr9:103225943..103225962 60.01 55
downstream ENSMUSE00000220756 Chr9:103226657..103226829 TGAAGAGGGGATTCGACTTG Chr9:103226714..103226733 60.19 50
downstream ENSMUSE00000220767 Chr9:103227972..103228183 AATGTTAACTGCCGGCAAAC Chr9:103228107..103228126 60 45
downstream ENSMUSE00000220750 Chr9:103230737..103231023 AAGCGATTCATGTCCAAAGG Chr9:103230863..103230882 60.07 45
downstream ENSMUSE00000220747 Chr9:103235015..103235185 ATTTGCCAAAGCAACTGTCA Chr9:103235125..103235144 59.32 40
downstream ENSMUSE00000220748 Chr9:103235275..103235384 CACAACGCTGTCAAGTGGTT Chr9:103235310..103235329 59.79 50
downstream ENSMUSE00000220764 Chr9:103236386..103236509 AATAGCCAATGCTCGGACAC Chr9:103236508..103236527 60.1 50
downstream ENSMUSE00000220752 Chr9:103238142..103238288 AGATGCAGAAACTGCCAAGG Chr9:103238279..103238298 60.4 50
downstream ENSMUSE00000220753 Chr9:103238394..103238496 CCACTCCCATTCAACAGAGG Chr9:103238479..103238498 60.5 55
downstream ENSMUSE00000220759 Chr9:103240510..103240702 TGGCTGACATGATCTCTTGC Chr9:103240578..103240597 59.95 50
downstream ENSMUSE00000220768 Chr9:103244258..103244478 GTCGTCCCAAATGATCTGCT Chr9:103244330..103244349 60.08 50
downstream ENSMUSE00000220765 Chr9:103245878..103246026 TGCTACTGGAGGCTCTGGTT Chr9:103245942..103245961 60.01 55
downstream ENSMUSE00000220766 Chr9:103246255..103246366 TTCTGTGCGTCTCCTCCTGT Chr9:103246285..103246304 61.01 55
downstream ENSMUSE00000220749 Chr9:103247121..103247284 GCGTCTAGGTAGGAGCGATG Chr9:103247259..103247278 60 60
downstream ENSMUSE00000220758 Chr9:103248072..103248209 AACAATGCCGGATTCTTGAC Chr9:103248209..103248228 59.94 45
downstream ENSMUSE00000220760 Chr9:103249014..103249103 GGCCGATCAACACGTAAAAT Chr9:103249060..103249079 59.83 45
downstream ENSMUSE00000220751 Chr9:103249257..103249418 AGCCTCTGCGATGAAAACTC Chr9:103249364..103249383 59.58 50
downstream ENSMUSE00000331710 Chr9:103252112..103252762 CGAGGCCGTTTGACTACATT Chr9:103252239..103252258 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATGTTAATCGCCTTGCAG Chr9:103208563..103208583 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGTCGTGACTGGGAAAA Chr9:103208563..103208583 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032555