Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23198
Trapped Gene
Mmp11 (ENSMUSG00000000901)
Vector Insertion
Chr 10: 75391255 - 75395078
Public Clones IST10083D1 (tigm) IST14960F10 (tigm) IST10083E1 (tigm)
Private Clones OST271915 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224537 (Chr10:75395079..75395220 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224537 (Chr10:75395079..75395220 -)
Downstram Exon
ENSMUSE00000224530 (Chr10:75391025..75391254 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224537 Chr10:75395079..75395220 No primer for this exon
upstream ENSMUSE00000710988 Chr10:75395079..75395220 No primer for this exon

*** Putative Vector Insertion (Chr 10: 75391255 - 75395078) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224530 Chr10:75391025..75391254 No primer for this exon
downstream ENSMUSE00000101927 Chr10:75390092..75390235 No primer for this exon
downstream ENSMUSE00000101918 Chr10:75389874..75390007 No primer for this exon
downstream ENSMUSE00000224504 Chr10:75389493..75389734 No primer for this exon
downstream ENSMUSE00000224494 Chr10:75389156..75389372 No primer for this exon
downstream ENSMUSE00000224486 Chr10:75388165..75388422 No primer for this exon
downstream ENSMUSE00000710729 Chr10:75386704..75386860 No primer for this exon
downstream ENSMUSE00000224478 Chr10:75385969..75386860 No primer for this exon
downstream ENSMUSE00000709249 Chr10:75385967..75386235 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr10:75395008..75395028 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGGGTAGGGTGCCTCTC Chr10:75395059..75395079 60.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTGTCTCCTCCGCTAATCG Chr10:75395164..75395184 62.19 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGACGTGACTGGGAAAACC Chr10:75395154..75395174 61.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000901