Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23202
Trapped Gene
Sept1 (ENSMUSG00000000486)
Vector Insertion
Chr 7: 134359484 - 134360203
Public Clones IST11097A3 (tigm) IST12996G11 (tigm) IST11781F11 (tigm) IST10831G8 (tigm)
IST10592G10 (tigm) IST12267G5 (tigm) IST14545D1 (tigm)
Private Clones OST271444 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201858 (Chr7:134360204..134360299 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201858 (Chr7:134360204..134360299 -)
Downstram Exon
ENSMUSE00000201867 (Chr7:134359382..134359483 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669447 Chr7:134361921..134362012 No primer for this exon
upstream ENSMUSE00000669453 Chr7:134361921..134361967 No primer for this exon
upstream ENSMUSE00000291022 Chr7:134361655..134361745 No primer for this exon
upstream ENSMUSE00000649239 Chr7:134361655..134361817 No primer for this exon
upstream ENSMUSE00000201863 Chr7:134361485..134361571 No primer for this exon
upstream ENSMUSE00000201860 Chr7:134361133..134361256 No primer for this exon
upstream ENSMUSE00000669452 Chr7:134360417..134360549 No primer for this exon
upstream ENSMUSE00000588043 Chr7:134360415..134360549 No primer for this exon
upstream ENSMUSE00000632379 Chr7:134360301..134360321 No primer for this exon
upstream ENSMUSE00000201858 Chr7:134360204..134360299 No primer for this exon
upstream ENSMUSE00000669446 Chr7:134360204..134360321 No primer for this exon

*** Putative Vector Insertion (Chr 7: 134359484 - 134360203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000201867 Chr7:134359382..134359483 No primer for this exon
downstream ENSMUSE00000201865 Chr7:134359173..134359269 No primer for this exon
downstream ENSMUSE00000201862 Chr7:134358795..134358960 No primer for this exon
downstream ENSMUSE00000201864 Chr7:134358463..134358553 No primer for this exon
downstream ENSMUSE00000632378 Chr7:134358157..134358358 No primer for this exon
downstream ENSMUSE00000669444 Chr7:134357976..134358358 No primer for this exon
downstream ENSMUSE00000669451 Chr7:134357964..134358358 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGGCCCCTAAGTGACAG Chr7:134360176..134360196 59.86 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAACCTTGTCCGTGACTG Chr7:134360144..134360164 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCCTAGATGTGGCTTTCCT Chr7:134360293..134360313 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATCGGTACGTGACTGGGAAA Chr7:134360236..134360256 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000486