Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23204
Trapped Gene
Arid5b (ENSMUSG00000019947)
Vector Insertion
Chr 10: 67589500 - 67591536
Public Clones PST23093-NR (escells)
Private Clones OST271390 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099312 (Chr10:67591537..67591741 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099312 (Chr10:67591537..67591741 -)
Downstram Exon
ENSMUSE00000099319 (Chr10:67589447..67589499 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666206 Chr10:67741438..67741474 No primer for this exon
upstream ENSMUSE00000393468 Chr10:67740678..67740932 No primer for this exon
upstream ENSMUSE00000289228 Chr10:67705752..67705977 No primer for this exon
upstream ENSMUSE00000099301 Chr10:67648774..67649004 No primer for this exon
upstream ENSMUSE00000099314 Chr10:67597742..67597854 No primer for this exon
upstream ENSMUSE00000099312 Chr10:67591537..67591741 No primer for this exon

*** Putative Vector Insertion (Chr 10: 67589500 - 67591536) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099319 Chr10:67589447..67589499 No primer for this exon
downstream ENSMUSE00000099321 Chr10:67580999..67581096 No primer for this exon
downstream ENSMUSE00000099298 Chr10:67564643..67564841 No primer for this exon
downstream ENSMUSE00000575802 Chr10:67558341..67561417 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAAGAAAAACGCCCATCG Chr10:67591565..67591585 61.46 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAAGAAAAACGCCCATCG Chr10:67591565..67591585 61.46 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr10:67591672..67591692 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGAAAGGAGAGGCCAGGTC Chr10:67591720..67591740 61.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019947