Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23219
Trapped Gene
Hsp90ab1 (ENSMUSG00000023944)
Vector Insertion
Chr 17: 45708127 - 45708361
Public Clones not available
Private Clones OST270326 (lexicon) OST169618 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000404358 (Chr17:45708362..45708568 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCCTGGACAAGATTCGATA Chr17:45708549..45708568 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000404358 (Chr17:45708362..45708568 -)
Downstram Exon
ENSMUSE00000136547 (Chr17:45707967..45708126 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCCTGGACAAGATTCGATA Chr17:45708549..45708568 60.04 50 AGAATCCGACACCAAACTGC Chr17:45708059..45708078 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696089 Chr17:45710116..45710220 CCACCACCCTGCTCTGTACT Chr17:45710138..45710157 60.17 60
upstream ENSMUSE00000136555 Chr17:45708714..45708860 AAGTGCACCATGGAGAGGAG Chr17:45708831..45708850 60.26 55
upstream ENSMUSE00000404358 Chr17:45708362..45708568 GCCCTGGACAAGATTCGATA Chr17:45708549..45708568 60.04 50

*** Putative Vector Insertion (Chr 17: 45708127 - 45708361) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136547 Chr17:45707967..45708126 AGAATCCGACACCAAACTGC Chr17:45708059..45708078 60.12 50
downstream ENSMUSE00000136551 Chr17:45707615..45707748 CTGCGAATGTTTCTTCACCA Chr17:45707620..45707639 59.84 45
downstream ENSMUSE00000136553 Chr17:45707207..45707515 CAAGTGGTCCTCCCAGTCAT Chr17:45707194..45707213 59.96 55
downstream ENSMUSE00000136557 Chr17:45706419..45706775 GATGTTCTTGCGGATGACCT Chr17:45706487..45706506 60.08 50
downstream ENSMUSE00000136550 Chr17:45706189..45706336 GCGTCGGTTAGTGGAATCTT Chr17:45706282..45706301 59.2 50
downstream ENSMUSE00000543014 Chr17:45705807..45706075 TCCCATCAAACTCCTTGAGC Chr17:45705925..45705944 60.19 50
downstream ENSMUSE00000136561 Chr17:45705178..45705511 CAGGGTTGATCTCCAGGTGT Chr17:45705330..45705349 59.96 55
downstream ENSMUSE00000657294 Chr17:45704728..45705073 TTCCAGGAGGCTTTAATCCA Chr17:45704930..45704949 59.64 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000023944