Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23220
Trapped Gene
Eif2s1 (ENSMUSG00000021116)
Vector Insertion
Chr 12: 79975631 - 79978078
Public Clones not available
Private Clones OST270303 (lexicon) OST135560 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000531264 (Chr12:79975551..79975630 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000531264 (Chr12:79975551..79975630 +)
Downstram Exon
ENSMUSE00000531262 (Chr12:79978079..79978230 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398090 Chr12:79963060..79963167 No primer for this exon
upstream ENSMUSE00000114770 Chr12:79967513..79967754 No primer for this exon
upstream ENSMUSE00000531264 Chr12:79975551..79975630 No primer for this exon

*** Putative Vector Insertion (Chr 12: 79975631 - 79978078) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000531262 Chr12:79978079..79978230 No primer for this exon
downstream ENSMUSE00000114768 Chr12:79980938..79981044 No primer for this exon
downstream ENSMUSE00000460762 Chr12:79982119..79982216 No primer for this exon
downstream ENSMUSE00000114779 Chr12:79984245..79984388 No primer for this exon
downstream ENSMUSE00000653837 Chr12:79985778..79986306 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGCAATCAAATGTGAGGA Chr12:79975589..79975610 60.07 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGCAATCAAATGTGAGGA Chr12:79975589..79975610 60.07 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021116