Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23223
Trapped Gene
Eif4a2 (ENSMUSG00000022884)
Vector Insertion
Chr 16: 23110227 - 23110306
Public Clones IST15052E9 (tigm)
Private Clones OST270107 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000131583 (Chr16:23110058..23110226 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCCCCTCACATTGTTGT Chr16:23110160..23110179 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000131583 (Chr16:23110058..23110226 +)
Downstram Exon
ENSMUSE00000560678 (Chr16:23110307..23110416 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCCCCTCACATTGTTGT Chr16:23110160..23110179 59.97 50 GCTTCGTCCAAAACGAACAT Chr16:23110346..23110365 60.12 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702513 Chr16:23107832..23107893 GGTTTTCGGATCATGTCTGG Chr16:23107853..23107872 60.32 50
upstream ENSMUSE00000131579 Chr16:23107836..23107893 GGTTTTCGGATCATGTCTGG Chr16:23107853..23107872 60.32 50
upstream ENSMUSE00000702530 Chr16:23108658..23108706 No primer for this exon
upstream ENSMUSE00000131587 Chr16:23108661..23108706 No primer for this exon
upstream ENSMUSE00000560686 Chr16:23108792..23108924 TCCCTTCTTCGAGGCATCTAT Chr16:23108843..23108863 60.18 47.62
upstream ENSMUSE00000560683 Chr16:23109193..23109332 TTCAAGGAGACCCAAGCACT Chr16:23109279..23109298 59.84 50
upstream ENSMUSE00000131583 Chr16:23110058..23110226 GAAGCCCCTCACATTGTTGT Chr16:23110160..23110179 59.97 50

*** Putative Vector Insertion (Chr 16: 23110227 - 23110306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000560678 Chr16:23110307..23110416 GCTTCGTCCAAAACGAACAT Chr16:23110346..23110365 60.12 45
downstream ENSMUSE00000560675 Chr16:23110653..23110796 AGCACATCAGTTGGCATTGT Chr16:23110693..23110712 59.17 45
downstream ENSMUSE00000560672 Chr16:23111199..23111336 ACCTTGCGCCTTGTATTGAG Chr16:23111287..23111306 60.27 50
downstream ENSMUSE00000131585 Chr16:23111576..23111665 GTGATCAGAACACGGCTTGA Chr16:23111655..23111674 59.84 50
downstream ENSMUSE00000131593 Chr16:23111890..23111969 CACTTGTTGCACGTCAATCC Chr16:23111919..23111938 60.16 50
downstream ENSMUSE00000343494 Chr16:23112424..23114019 AATTACGTCAACGCCGTTTC Chr16:23112483..23112502 60 45
downstream ENSMUSE00000498578 Chr16:23113240..23113384 ACCTTTCCTCCCAAATCGAC Chr16:23113276..23113295 60.31 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTACTCCAGGGAGAGTGTTTG Chr16:23110182..23110204 60.03 54.54 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAACTTCGTGACTGGGAAA Chr16:23110270..23110291 59.32 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022884