Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23229
Trapped Gene
Clu (ENSMUSG00000022037)
Vector Insertion
Chr 14: 66587526 - 66590568
Public Clones not available
Private Clones OST269992 (lexicon) OST62924 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686812 (Chr14:66587491..66587525 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686812 (Chr14:66587491..66587525 +)
Downstram Exon
ENSMUSE00000269494 (Chr14:66590569..66590689 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCCTCCTTGGAATCTGGAGT Chr14:66590592..66590611 60.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686812 Chr14:66587491..66587525 No primer for this exon

*** Putative Vector Insertion (Chr 14: 66587526 - 66590568) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000269494 Chr14:66590569..66590689 GCCTCCTTGGAATCTGGAGT Chr14:66590592..66590611 60.6 55
downstream ENSMUSE00000123111 Chr14:66592162..66592310 CGGCGTTCTGAATCTCCTTA Chr14:66592215..66592234 60.34 50
downstream ENSMUSE00000123107 Chr14:66593680..66593850 GGCCATCATGGTCTCGTTAC Chr14:66593760..66593779 60.35 55
downstream ENSMUSE00000497161 Chr14:66594418..66594829 GGTCCTGAAAGAGCGTGTCT Chr14:66594583..66594602 59.46 55
downstream ENSMUSE00000123109 Chr14:66595743..66595847 TCCTGGCACTTTTCACACTG Chr14:66595836..66595855 59.87 50
downstream ENSMUSE00000123110 Chr14:66598488..66598717 GCATCTTCGACTGGAAGGAC Chr14:66598613..66598632 59.81 55
downstream ENSMUSE00000269459 Chr14:66599691..66599866 TCCTGCGGTATTCCTGTAGC Chr14:66599862..66599881 60.24 55
downstream ENSMUSE00000686806 Chr14:66600145..66600384 AAGGCGGCTTTTATTGGATT Chr14:66600377..66600396 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGCAGGGTGCAGAAAACC Chr14:66587503..66587523 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGCAGGGTGCAGAAAACC Chr14:66587503..66587523 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022037