Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23248
Trapped Gene
March9 (ENSMUSG00000040502)
Vector Insertion
Chr 10: 126494681 - 126495275
Public Clones not available
Private Clones OST269426 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373460 (Chr10:126495276..126495431 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATGGAGCTGTGAGCTTTG Chr10:126495325..126495344 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373460 (Chr10:126495276..126495431 -)
Downstram Exon
ENSMUSE00000573503 (Chr10:126494488..126494680 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATGGAGCTGTGAGCTTTG Chr10:126495325..126495344 60.14 50 GCAGCAATCTGGACCTTCTC Chr10:126494612..126494631 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607350 Chr10:126496454..126497240 CATGTTCCTGAACGAGCTGA Chr10:126496771..126496790 59.98 50
upstream ENSMUSE00000373460 Chr10:126495276..126495431 TCATGGAGCTGTGAGCTTTG Chr10:126495325..126495344 60.14 50

*** Putative Vector Insertion (Chr 10: 126494681 - 126495275) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000573503 Chr10:126494488..126494680 GCAGCAATCTGGACCTTCTC Chr10:126494612..126494631 59.96 55
downstream ENSMUSE00000451762 Chr10:126493106..126493967 TGGCATTGGTCTCCCTTTAC Chr10:126493252..126493271 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAATCCACTGCAGGTGAGG Chr10:126495268..126495288 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCAGGGAACCTATTTTCG Chr10:126495222..126495242 60.07 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040502