Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2325
Trapped Gene
Hsf2 (ENSMUSG00000019878)
Vector Insertion
Chr 10: 57219298 - 57221175
Public Clones AP0649 (sanger) AE0204 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098776 (Chr10:57219222..57219297 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098776 (Chr10:57219222..57219297 +)
Downstram Exon
ENSMUSE00000098769 (Chr10:57221176..57221237 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436890 Chr10:57206292..57206407 No primer for this exon
upstream ENSMUSE00000098773 Chr10:57215704..57215812 No primer for this exon
upstream ENSMUSE00000098772 Chr10:57215961..57216088 No primer for this exon
upstream ENSMUSE00000098777 Chr10:57217303..57217427 No primer for this exon
upstream ENSMUSE00000098776 Chr10:57219222..57219297 No primer for this exon

*** Putative Vector Insertion (Chr 10: 57219298 - 57221175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098769 Chr10:57221176..57221237 No primer for this exon
downstream ENSMUSE00000098765 Chr10:57222429..57222516 No primer for this exon
downstream ENSMUSE00000098775 Chr10:57224388..57224536 No primer for this exon
downstream ENSMUSE00000098774 Chr10:57224952..57225188 No primer for this exon
downstream ENSMUSE00000098771 Chr10:57226003..57226108 No primer for this exon
downstream ENSMUSE00000413549 Chr10:57228867..57228920 No primer for this exon
downstream ENSMUSE00000098768 Chr10:57231250..57231334 No primer for this exon
downstream ENSMUSE00000467898 Chr10:57231709..57232941 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGCTCTGCATTTGCTTGT Chr10:57219321..57219341 60.61 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGCTCTGCATTTGCTTGT Chr10:57219321..57219341 60.61 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019878