Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23258
Trapped Gene
Nicn1 (ENSMUSG00000032606)
Vector Insertion
Chr 9: 108192994 - 108195666
Public Clones CMHD-GT_476G4-3 (cmhd) IST13022G10 (tigm) IST11319B1 (tigm) IST11319B1 (tigm)
Private Clones OST268956 (lexicon) OST209625 (lexicon) OST123837 (lexicon) OST1032 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221508 (Chr9:108192779..108192993 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAAGGGACGCCAATAAGAGC Chr9:108192785..108192804 59.32 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221508 (Chr9:108192779..108192993 +)
Downstram Exon
ENSMUSE00000221504 (Chr9:108195667..108195843 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAAGGGACGCCAATAAGAGC Chr9:108192785..108192804 59.32 50 GTTACCCACTTGGCTGCTGT Chr9:108195764..108195783 60.18 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221508 Chr9:108192779..108192993 TAAGGGACGCCAATAAGAGC Chr9:108192785..108192804 59.32 50

*** Putative Vector Insertion (Chr 9: 108192994 - 108195666) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221504 Chr9:108195667..108195843 GTTACCCACTTGGCTGCTGT Chr9:108195764..108195783 60.18 55
downstream ENSMUSE00000221503 Chr9:108196262..108196375 CTGCAGTTCCTCCACTGTGA Chr9:108196357..108196376 60.02 55
downstream ENSMUSE00000221507 Chr9:108196777..108196848 CAGGCTGCTCATTGGACACT Chr9:108196837..108196856 61.42 55
downstream ENSMUSE00000221505 Chr9:108197220..108197324 TCTCTGTCAGTGCCCACATC Chr9:108197283..108197302 59.83 55
downstream ENSMUSE00000392675 Chr9:108197399..108198829 AACTTGGATGCACAGGGAAC Chr9:108197530..108197549 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCACTTTTCCCAACATCG Chr9:108192964..108192984 59.54 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCACTTTTCCCAACATCG Chr9:108192964..108192984 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032606