Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2326
Trapped Gene
Usp28 (ENSMUSG00000032267)
Vector Insertion
Chr 9: 48793643 - 48808455
Public Clones AE0197 (sanger) AG0122 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479060 (Chr9:48793490..48793642 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACAACGAGAGTGGGGCTAC Chr9:48793545..48793564 59.73 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479060 (Chr9:48793490..48793642 +)
Downstram Exon
ENSMUSE00000478045 (Chr9:48808456..48808533 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACAACGAGAGTGGGGCTAC Chr9:48793545..48793564 59.73 60 GATCCTGGATGCCTGTGATT Chr9:48808510..48808529 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479060 Chr9:48793490..48793642 GACAACGAGAGTGGGGCTAC Chr9:48793545..48793564 59.73 60

*** Putative Vector Insertion (Chr 9: 48793643 - 48808455) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699592 Chr9:48808455..48808533 GATCCTGGATGCCTGTGATT Chr9:48808510..48808529 59.89 50
downstream ENSMUSE00000478045 Chr9:48808456..48808533 GATCCTGGATGCCTGTGATT Chr9:48808510..48808529 59.89 50
downstream ENSMUSE00000502520 Chr9:48809613..48809745 AGCAGTTGTGTCGTGACTGG Chr9:48809696..48809715 59.94 55
downstream ENSMUSE00000699590 Chr9:48809613..48809745 AGCAGTTGTGTCGTGACTGG Chr9:48809696..48809715 59.94 55
downstream ENSMUSE00000247372 Chr9:48811096..48811201 GCCTGCAGGTCATCTTTGTT Chr9:48811141..48811160 60.26 50
downstream ENSMUSE00000699589 Chr9:48811096..48811201 GCCTGCAGGTCATCTTTGTT Chr9:48811141..48811160 60.26 50
downstream ENSMUSE00000247816 Chr9:48811928..48812087 CCCAAACTTCACAGCGTTTT Chr9:48811992..48812011 60.15 45
downstream ENSMUSE00000699587 Chr9:48811928..48812087 CCCAAACTTCACAGCGTTTT Chr9:48811992..48812011 60.15 45
downstream ENSMUSE00000247793 Chr9:48816534..48816620 AGGATGTTCTGTGGCAGGTT Chr9:48816601..48816620 59.58 50
downstream ENSMUSE00000699586 Chr9:48816534..48816620 AGGATGTTCTGTGGCAGGTT Chr9:48816601..48816620 59.58 50
downstream ENSMUSE00000247768 Chr9:48817201..48817338 TGATCCCAACAACAGAGCAA Chr9:48817266..48817285 60.24 45
downstream ENSMUSE00000699584 Chr9:48817201..48817338 TGATCCCAACAACAGAGCAA Chr9:48817266..48817285 60.24 45
downstream ENSMUSE00000501591 Chr9:48818348..48818421 ATCCAGGAGCTTGTGTGTGA Chr9:48818386..48818405 59.26 50
downstream ENSMUSE00000699583 Chr9:48818348..48818421 ATCCAGGAGCTTGTGTGTGA Chr9:48818386..48818405 59.26 50
downstream ENSMUSE00000342673 Chr9:48819368..48819447 GCACCATGGGATTTTCAGAT Chr9:48819408..48819427 59.76 45
downstream ENSMUSE00000699582 Chr9:48819368..48819447 GCACCATGGGATTTTCAGAT Chr9:48819408..48819427 59.76 45
downstream ENSMUSE00000247710 Chr9:48823207..48823355 AGAGGATACTGGCCGAAGGT Chr9:48823252..48823271 60.1 55
downstream ENSMUSE00000699580 Chr9:48823207..48823355 AGAGGATACTGGCCGAAGGT Chr9:48823252..48823271 60.1 55
downstream ENSMUSE00000247685 Chr9:48824787..48824914 AACACTGGAGGCAGCTTTGT Chr9:48824818..48824837 59.91 50
downstream ENSMUSE00000247673 Chr9:48826477..48826572 TCAACTTCCGAACGCTCTCT Chr9:48826538..48826557 60.13 50
downstream ENSMUSE00000247649 Chr9:48832011..48832190 CACCGAGGGAAGTGGTAATG Chr9:48832158..48832177 60.37 55
downstream ENSMUSE00000247343 Chr9:48833873..48834093 CTGGGAAGAGCATCTTCTGG Chr9:48833944..48833963 59.94 55
downstream ENSMUSE00000247181 Chr9:48834924..48834994 TCGTGCTGCTCGAGATACAG Chr9:48834956..48834975 60.31 55
downstream ENSMUSE00000370627 Chr9:48836178..48836406 GAAGTGGGGCAAGTTGTCAT Chr9:48836402..48836421 59.97 50
downstream ENSMUSE00000408618 Chr9:48838832..48839026 CCTCTTGCTGAAACCTCCAG Chr9:48838939..48838958 59.98 55
downstream ENSMUSE00000247128 Chr9:48840319..48840458 GAAGACAAGCATCGGACCTC Chr9:48840364..48840383 59.81 55
downstream ENSMUSE00000369001 Chr9:48840614..48840793 TTCTTGGGCTCAGCTTCATT Chr9:48840639..48840658 59.96 45
downstream ENSMUSE00000247286 Chr9:48841682..48841777 AAAGGTCTGGCGTGCTTTAG Chr9:48841747..48841766 59.52 50
downstream ENSMUSE00000247573 Chr9:48843698..48843876 CTACCCTCTTGGGTGCTTCA Chr9:48843824..48843843 60.25 55
downstream ENSMUSE00000247549 Chr9:48843987..48844065 TTCCATCAATTTGGCCTGAG Chr9:48844032..48844051 60.97 45
downstream ENSMUSE00000218240 Chr9:48845282..48845361 GGCCCGTTAGAAGGTACACA Chr9:48845342..48845361 59.99 55
downstream ENSMUSE00000218242 Chr9:48845873..48845996 TGCGGTATAAGGCAATCACA Chr9:48845985..48846004 60.1 45
downstream ENSMUSE00000218239 Chr9:48847087..48847282 GTCGTCCTTGGAGATGTCGT Chr9:48847224..48847243 60.12 55
downstream ENSMUSE00000350328 Chr9:48849479..48850622 CAGACACCCAATCCCTCTGT Chr9:48849760..48849779 59.96 55
downstream ENSMUSE00000699579 Chr9:48849479..48850615 CAGACACCCAATCCCTCTGT Chr9:48849760..48849779 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:48805693..48805713 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAATAACGTGACTGGGAAAACC Chr9:48805687..48805710 59.32 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032267