Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23269
Trapped Gene
Mat2b (ENSMUSG00000042032)
Vector Insertion
Chr 11: 40498987 - 40501298
Public Clones not available
Private Clones OST267933 (lexicon) OST254739 (lexicon) OST238311 (lexicon) OST149150 (lexicon)
OST145492 (lexicon) OST100565 (lexicon) OST50211 (lexicon) OST45534 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000267719 (Chr11:40501103..40501297 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTTCGAAGAGCAAGACCA Chr11:40501166..40501185 60.66 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000267719 (Chr11:40501103..40501297 -)
Downstram Exon
ENSMUSE00000679834 (Chr11:40498988..40501297 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTTCGAAGAGCAAGACCA Chr11:40501166..40501185 60.66 50 CTAACACTTCACGGCAAGCA Chr11:40500768..40500787 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654336 Chr11:40508305..40508325 No primer for this exon
upstream ENSMUSE00000267725 Chr11:40505980..40506147 AGCTCTCCATCCACTTCGTC Chr11:40506004..40506023 59.41 55
upstream ENSMUSE00000679835 Chr11:40505980..40506130 AGCTCTCCATCCACTTCGTC Chr11:40506004..40506023 59.41 55
upstream ENSMUSE00000267719 Chr11:40501103..40501297 GCTTTCGAAGAGCAAGACCA Chr11:40501166..40501185 60.66 50
upstream ENSMUSE00000679834 Chr11:40498988..40501297 TGCTTGCCGTGAAGTGTTAG Chr11:40500790..40500809 60.05 50

*** Putative Vector Insertion (Chr 11: 40498987 - 40501298) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000267715 Chr11:40498729..40498843 AGCAGCATCTGGCTGACTCT Chr11:40498753..40498772 60.31 55
downstream ENSMUSE00000267710 Chr11:40498184..40498336 TCCAGGACTGCTTTTTCTCC Chr11:40498173..40498192 59.4 50
downstream ENSMUSE00000267702 Chr11:40495966..40496159 TGAACTGCACCTTGTCGAAC Chr11:40496045..40496064 59.88 50
downstream ENSMUSE00000267693 Chr11:40494158..40494271 ATTGCACACGCCATTTCATA Chr11:40494176..40494195 59.96 40
downstream ENSMUSE00000335852 Chr11:40492818..40493696 AATTTGGAGCAATCGAGCTG Chr11:40493610..40493629 60.35 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGGGTTCTCATTACTGGTG Chr11:40501253..40501273 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGGGTTCTCATTACTGGTG Chr11:40501253..40501273 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042032